Incidental Mutation 'R6238:Ankrd13a'
ID505045
Institutional Source Beutler Lab
Gene Symbol Ankrd13a
Ensembl Gene ENSMUSG00000041870
Gene Nameankyrin repeat domain 13a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114774677-114806200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114786726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 91 (Y91H)
Ref Sequence ENSEMBL: ENSMUSP00000099638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102578]
Predicted Effect probably benign
Transcript: ENSMUST00000102578
AA Change: Y91H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099638
Gene: ENSMUSG00000041870
AA Change: Y91H

DomainStartEndE-ValueType
ANK 40 69 1.51e-4 SMART
ANK 73 104 2.03e-1 SMART
Pfam:GPCR_chapero_1 156 468 5.5e-107 PFAM
UIM 480 500 2.98e2 SMART
UIM 517 536 2.01e1 SMART
UIM 547 566 5.33e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137519
AA Change: Y24H
SMART Domains Protein: ENSMUSP00000116994
Gene: ENSMUSG00000041870
AA Change: Y24H

DomainStartEndE-ValueType
ANK 7 38 2.03e-1 SMART
Pfam:GPCR_chapero_1 90 403 8.2e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140604
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Ankrd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Ankrd13a APN 5 114801802 missense probably damaging 0.99
IGL01303:Ankrd13a APN 5 114786002 missense possibly damaging 0.94
IGL01392:Ankrd13a APN 5 114797853 missense probably benign
IGL01480:Ankrd13a APN 5 114800818 splice site probably benign
IGL01652:Ankrd13a APN 5 114791336 missense probably damaging 1.00
IGL02213:Ankrd13a APN 5 114785968 missense probably damaging 1.00
IGL02512:Ankrd13a APN 5 114786766 missense probably benign 0.16
IGL03268:Ankrd13a APN 5 114792235 missense probably damaging 1.00
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0465:Ankrd13a UTSW 5 114804234 missense probably damaging 0.98
R0960:Ankrd13a UTSW 5 114786807 missense probably benign 0.03
R1222:Ankrd13a UTSW 5 114800763 nonsense probably null
R1538:Ankrd13a UTSW 5 114804234 missense possibly damaging 0.87
R1667:Ankrd13a UTSW 5 114786733 missense possibly damaging 0.89
R1771:Ankrd13a UTSW 5 114803588 missense probably benign 0.08
R2015:Ankrd13a UTSW 5 114792109 missense probably damaging 1.00
R4547:Ankrd13a UTSW 5 114775296 missense probably benign 0.01
R4569:Ankrd13a UTSW 5 114789312 missense probably damaging 1.00
R5401:Ankrd13a UTSW 5 114792173 missense probably damaging 1.00
R5635:Ankrd13a UTSW 5 114801717 missense possibly damaging 0.95
R6562:Ankrd13a UTSW 5 114804392 unclassified probably benign
R6623:Ankrd13a UTSW 5 114786757 missense probably benign 0.28
R6772:Ankrd13a UTSW 5 114801743 missense probably benign 0.00
R7146:Ankrd13a UTSW 5 114775232 missense probably damaging 1.00
R7440:Ankrd13a UTSW 5 114803575 missense possibly damaging 0.65
R7567:Ankrd13a UTSW 5 114789484 intron probably null
R7849:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R7932:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R8006:Ankrd13a UTSW 5 114804423 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGCCGAGTTTTCTTCAGAGGAG -3'
(R):5'- GACTTAAGGAACCTTGACACCC -3'

Sequencing Primer
(F):5'- AGTTAGCAGCAGCCGTCCATAG -3'
(R):5'- TTGACACCCAAGGCCGTG -3'
Posted On2018-02-28