Mutagenetix > Incidental Mutations

Incidental Mutation 'R6238:Fzd10'

505047

Institutional Source

Beutler Lab

Gene Symbol

Fzd10

Ensembl Gene

ENSMUSG00000081683

Gene Name

frizzled class receptor 10

Synonyms

Fz-10

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6238 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128600844-128604093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128602931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 572 (Y572H)

Ref Sequence

ENSEMBL: ENSMUSP00000114114 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117102]

AlphaFold

Q8BKG4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000091324

Predicted Effect

probably damaging
Transcript: ENSMUST00000117102
AA Change: Y572H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: Y572H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FRI	34	153	7.83e-68	SMART
Frizzled	218	542	2.62e-207	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199981

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	C	10: 76,449,262	T2P	possibly damaging	Het
2610042L04Rik	A	G	14: 4,348,962	N41S	probably damaging	Het
4933402N03Rik	T	C	7: 131,146,134	D43G	probably benign	Het
Adcy10	C	A	1: 165,575,728	Y1598*	probably null	Het
Adgrv1	G	A	13: 81,466,283	T3997M	probably benign	Het
Amfr	A	C	8: 94,000,364	F74V	probably damaging	Het
Ankrd13a	T	C	5: 114,786,726	Y91H	probably benign	Het
Baiap3	A	G	17: 25,245,758	S767P	probably benign	Het
Car12	C	T	9: 66,753,726	T124I	probably damaging	Het
Casp9	G	T	4: 141,807,137	G286V	probably damaging	Het
Cc2d2a	T	A	5: 43,671,235	D18E	probably benign	Het
Cdc27	T	C	11: 104,528,444	N221D	probably damaging	Het
Cebpz	A	G	17: 78,936,910	S41P	possibly damaging	Het
Cenpo	T	A	12: 4,231,968	S10C	possibly damaging	Het
Chid1	A	G	7: 141,496,136	V368A	probably benign	Het
Clca1	C	A	3: 145,008,955	V634L	probably benign	Het
Cmtr1	A	G	17: 29,682,148	D683G	probably damaging	Het
Cpsf3	G	T	12: 21,300,162	R294L	probably damaging	Het
Ddrgk1	G	A	2: 130,654,679	T255M	possibly damaging	Het
Dennd6a	T	A	14: 26,616,658		probably null	Het
Dnah10	A	G	5: 124,743,679	R526G	probably damaging	Het
Dock3	G	A	9: 106,912,948	T1484I	probably benign	Het
Efcab10	T	C	12: 33,398,434	Y89H	probably damaging	Het
Etl4	T	A	2: 20,801,568	D1200E	probably damaging	Het
Fbn1	T	A	2: 125,324,945	D2017V	probably damaging	Het
Ftmt	G	A	18: 52,332,235	V208M	probably damaging	Het
Gcc1	T	C	6: 28,420,743	K39E	probably damaging	Het
Hydin	A	G	8: 110,392,111		probably null	Het
Lif	A	G	11: 4,268,940	E73G	possibly damaging	Het
Lrtm1	C	A	14: 29,027,671	Q357K	probably benign	Het
Mef2d	T	A	3: 88,159,545	L205Q	probably damaging	Het
Naalad2	T	A	9: 18,385,065	E96D	probably damaging	Het
Nbas	T	C	12: 13,482,595	I1768T	probably benign	Het
Nodal	T	C	10: 61,423,479	S232P	probably damaging	Het
Olfr598	A	T	7: 103,328,908	I141F	possibly damaging	Het
Olfr876	A	G	9: 37,804,021	T37A	probably benign	Het
Parl	G	A	16: 20,302,213	R39C	possibly damaging	Het
Pcdha9	G	A	18: 36,998,975	V366I	probably benign	Het
Pdzd8	A	G	19: 59,300,562	V802A	probably benign	Het
Plcl2	T	C	17: 50,606,845	V294A	probably damaging	Het
Plxna2	T	A	1: 194,790,196	S1083T	probably benign	Het
Polr2a	G	T	11: 69,747,221	L141I	possibly damaging	Het
Ptpre	C	A	7: 135,671,180	R468S	probably damaging	Het
Raet1e	T	A	10: 22,180,871	N115K	probably benign	Het
Rfx8	C	A	1: 39,670,394	S491I	probably damaging	Het
Rpe	T	A	1: 66,701,648	L48*	probably null	Het
Skint5	A	T	4: 113,942,867		probably null	Het
Spata24	C	A	18: 35,660,336	S111I	possibly damaging	Het
Suz12	G	C	11: 80,002,180		probably benign	Het
Taf4	T	A	2: 179,932,039	I679F	probably damaging	Het
Tlr1	G	T	5: 64,927,129	P35Q	possibly damaging	Het
Tonsl	T	C	15: 76,636,218		probably null	Het
Tsen54	G	A	11: 115,820,687	R310H	probably benign	Het
Ttc7b	A	G	12: 100,495,422	S99P	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uhmk1	T	A	1: 170,199,994	N378I	probably damaging	Het
Vmn2r107	A	G	17: 20,345,587	T55A	probably benign	Het
Vmn2r74	C	T	7: 85,952,072	C786Y	probably damaging	Het
Wdr20rt	C	T	12: 65,226,190		probably benign	Het
Zfand2a	T	A	5: 139,481,991	H42L	probably damaging	Het
Zfp990	T	A	4: 145,537,913	C494S	probably damaging	Het
Zkscan4	A	T	13: 21,484,587	R403W	possibly damaging	Het

Other mutations in Fzd10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Fzd10	APN	5	128601528	missense	probably damaging	1.00
IGL02354:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL02361:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL03088:Fzd10	APN	5	128602605	missense	possibly damaging	0.81
R0530:Fzd10	UTSW	5	128602013	missense	probably damaging	1.00
R0645:Fzd10	UTSW	5	128602598	missense	possibly damaging	0.94
R1515:Fzd10	UTSW	5	128602559	missense	probably damaging	1.00
R3930:Fzd10	UTSW	5	128602412	missense	probably damaging	1.00
R4467:Fzd10	UTSW	5	128601276	missense	probably benign	0.01
R4976:Fzd10	UTSW	5	128602114	nonsense	probably null
R5156:Fzd10	UTSW	5	128601302	missense	possibly damaging	0.68
R5202:Fzd10	UTSW	5	128602116	missense	possibly damaging	0.78
R5874:Fzd10	UTSW	5	128601300	missense	probably benign	0.41
R6921:Fzd10	UTSW	5	128601582	missense	probably damaging	0.99
R7684:Fzd10	UTSW	5	128601416	missense	possibly damaging	0.73
R8093:Fzd10	UTSW	5	128602239	missense	probably benign	0.14
R9011:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9013:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9014:Fzd10	UTSW	5	128602305	missense	probably damaging	1.00
R9332:Fzd10	UTSW	5	128601252	missense	possibly damaging	0.92
Z1088:Fzd10	UTSW	5	128601246	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGTGTCCATGCTGCTGGTG -3'
(R):5'- CAGCTGTTCTGAACCTCAAGGTAG -3'

Sequencing Primer
(F):5'- CTGGTGGTGGGCATCAC -3'
(R):5'- CCTCAAGGTAGACTTCATGTATGTG -3'

Posted On

2018-02-28