Incidental Mutation 'R6238:Fzd10'
ID 505047
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6238 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128602931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 572 (Y572H)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091324
Predicted Effect probably damaging
Transcript: ENSMUST00000117102
AA Change: Y572H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: Y572H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTGTCCATGCTGCTGGTG -3'
(R):5'- CAGCTGTTCTGAACCTCAAGGTAG -3'

Sequencing Primer
(F):5'- CTGGTGGTGGGCATCAC -3'
(R):5'- CCTCAAGGTAGACTTCATGTATGTG -3'
Posted On 2018-02-28