Incidental Mutation 'R6238:Naalad2'
ID505057
Institutional Source Beutler Lab
Gene Symbol Naalad2
Ensembl Gene ENSMUSG00000043943
Gene NameN-acetylated alpha-linked acidic dipeptidase 2
SynonymsNAADALASE2, GCP3, NAALADASE2, Folh1b, GCPIII, D9Ertd285e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18321951-18402995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18385065 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 96 (E96D)
Ref Sequence ENSEMBL: ENSMUSP00000133157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001826] [ENSMUST00000101453] [ENSMUST00000164081] [ENSMUST00000166825] [ENSMUST00000172116] [ENSMUST00000172171]
Predicted Effect probably benign
Transcript: ENSMUST00000001826
AA Change: E96D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001826
Gene: ENSMUSG00000043943
AA Change: E96D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 198 290 2.2e-14 PFAM
Pfam:Peptidase_M28 385 593 9.4e-22 PFAM
Pfam:TFR_dimer 655 775 1.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101453
Predicted Effect probably benign
Transcript: ENSMUST00000164081
Predicted Effect probably benign
Transcript: ENSMUST00000166825
AA Change: E58D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128674
Gene: ENSMUSG00000043943
AA Change: E58D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PA 155 253 2.8e-14 PFAM
Pfam:Peptidase_M28 360 554 8.2e-18 PFAM
Pfam:TFR_dimer 616 739 3.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168934
Predicted Effect probably damaging
Transcript: ENSMUST00000172116
AA Change: E96D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133157
Gene: ENSMUSG00000043943
AA Change: E96D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172171
AA Change: E96D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130752
Gene: ENSMUSG00000043943
AA Change: E96D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 193 291 3.5e-14 PFAM
Pfam:Peptidase_M28 398 592 1.2e-17 PFAM
Pfam:TFR_dimer 654 777 6.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172200
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Naalad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Naalad2 APN 9 18327373 missense probably damaging 0.97
IGL02160:Naalad2 APN 9 18379937 missense probably damaging 1.00
IGL03246:Naalad2 APN 9 18385099 missense possibly damaging 0.92
IGL03351:Naalad2 APN 9 18364187 missense possibly damaging 0.57
ithaca UTSW 9 18378699 missense probably damaging 1.00
odysseus UTSW 9 18376533 missense possibly damaging 0.63
R0112:Naalad2 UTSW 9 18351447 nonsense probably null
R0266:Naalad2 UTSW 9 18350943 splice site probably benign
R0505:Naalad2 UTSW 9 18385895 missense probably benign
R1077:Naalad2 UTSW 9 18347506 missense probably damaging 1.00
R1442:Naalad2 UTSW 9 18351032 splice site probably benign
R1553:Naalad2 UTSW 9 18378669 missense probably benign 0.01
R1694:Naalad2 UTSW 9 18327387 missense probably damaging 0.96
R1912:Naalad2 UTSW 9 18376535 missense probably benign 0.00
R1976:Naalad2 UTSW 9 18378699 missense probably damaging 1.00
R2224:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2225:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2227:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2287:Naalad2 UTSW 9 18335021 splice site probably null
R4126:Naalad2 UTSW 9 18347470 missense probably damaging 1.00
R4784:Naalad2 UTSW 9 18350918 missense probably damaging 1.00
R5426:Naalad2 UTSW 9 18347519 missense probably benign 0.11
R5470:Naalad2 UTSW 9 18330851 missense probably damaging 1.00
R5644:Naalad2 UTSW 9 18334931 missense possibly damaging 0.90
R5888:Naalad2 UTSW 9 18330641 missense probably benign 0.34
R6194:Naalad2 UTSW 9 18351147 missense probably benign 0.23
R6701:Naalad2 UTSW 9 18385148 missense probably null 0.05
R6764:Naalad2 UTSW 9 18402889 start gained probably benign
R6791:Naalad2 UTSW 9 18385130 missense possibly damaging 0.67
R7133:Naalad2 UTSW 9 18327377 missense probably benign 0.00
R7137:Naalad2 UTSW 9 18323487 missense probably benign 0.00
R7212:Naalad2 UTSW 9 18364041 intron probably null
R7588:Naalad2 UTSW 9 18351479 missense probably damaging 0.99
Z1177:Naalad2 UTSW 9 18351102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCTACAACAGGCCGTG -3'
(R):5'- GGTGTCTCCTTTAATAGTCAGAAGC -3'

Sequencing Primer
(F):5'- TACAACAGGCCGTGGCTTTC -3'
(R):5'- TCAGAAGCAATTAATGTGCACGTG -3'
Posted On2018-02-28