Incidental Mutation 'R6238:Olfr876'
ID505058
Institutional Source Beutler Lab
Gene Symbol Olfr876
Ensembl Gene ENSMUSG00000066750
Gene Nameolfactory receptor 876
SynonymsGA_x6K02T2PVTD-31489645-31490577, MOR161-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37803031-37808144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37804021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000149930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086064] [ENSMUST00000213368] [ENSMUST00000215287]
Predicted Effect probably benign
Transcript: ENSMUST00000086064
AA Change: T37A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083231
Gene: ENSMUSG00000066750
AA Change: T37A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.6e-47 PFAM
Pfam:7tm_1 40 289 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213368
AA Change: T37A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215287
AA Change: T37A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Olfr876
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Olfr876 APN 9 37804782 missense probably damaging 1.00
IGL01330:Olfr876 APN 9 37804220 missense probably damaging 1.00
IGL02105:Olfr876 APN 9 37804595 missense possibly damaging 0.53
IGL02505:Olfr876 APN 9 37804331 missense probably benign 0.08
R1543:Olfr876 UTSW 9 37803947 missense possibly damaging 0.94
R1768:Olfr876 UTSW 9 37804303 missense probably damaging 1.00
R1960:Olfr876 UTSW 9 37803946 missense probably benign 0.01
R2567:Olfr876 UTSW 9 37804213 missense probably damaging 1.00
R3815:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3816:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3817:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3819:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R4364:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4366:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4620:Olfr876 UTSW 9 37804819 missense probably benign 0.02
R5530:Olfr876 UTSW 9 37804807 missense probably benign 0.00
R6199:Olfr876 UTSW 9 37804881 utr 3 prime probably null
R6893:Olfr876 UTSW 9 37804845 makesense probably null
R7404:Olfr876 UTSW 9 37803961 missense possibly damaging 0.80
R7806:Olfr876 UTSW 9 37804576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGGATTCCATTTTCACAGGGAG -3'
(R):5'- ATGCACCCTGGATGTGAGATG -3'

Sequencing Primer
(F):5'- CCATTTTCACAGGGAGAACATAG -3'
(R):5'- CACCCTGGATGTGAGATGATGTTC -3'
Posted On2018-02-28