Incidental Mutation 'R6238:Car12'
ID505059
Institutional Source Beutler Lab
Gene Symbol Car12
Ensembl Gene ENSMUSG00000032373
Gene Namecarbonic anhydrase 12
Synonyms2310047E01Rik, CA XII
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location66713686-66766845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66753726 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 124 (T124I)
Ref Sequence ENSEMBL: ENSMUSP00000118030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071889] [ENSMUST00000085420] [ENSMUST00000134829]
Predicted Effect probably damaging
Transcript: ENSMUST00000071889
AA Change: T261I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071786
Gene: ENSMUSG00000032373
AA Change: T261I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 32 290 8.86e-126 SMART
transmembrane domain 305 327 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085420
AA Change: T261I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082541
Gene: ENSMUSG00000032373
AA Change: T261I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 32 290 8.86e-126 SMART
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134829
AA Change: T124I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118030
Gene: ENSMUSG00000032373
AA Change: T124I

DomainStartEndE-ValueType
Carb_anhydrase 1 153 3.06e-15 SMART
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152011
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound member of the alpha carbonic anhydrase family of enzymes that catalyze the reversible hydration of carbon dioxide to bicarbonate. These proteins participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transposon-induced mutation that inactivates this gene display reduced fitness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Car12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Car12 APN 9 66763270 missense possibly damaging 0.73
IGL02280:Car12 APN 9 66746575 missense probably damaging 1.00
IGL02347:Car12 APN 9 66764347 missense possibly damaging 0.62
IGL02582:Car12 APN 9 66713877 missense probably benign
IGL02612:Car12 APN 9 66762424 missense probably damaging 0.97
IGL02645:Car12 APN 9 66747679 missense probably benign 0.42
LCD18:Car12 UTSW 9 66761676 intron probably benign
R2033:Car12 UTSW 9 66717558 critical splice acceptor site probably null
R2118:Car12 UTSW 9 66713892 missense probably benign 0.05
R2263:Car12 UTSW 9 66747631 nonsense probably null
R3111:Car12 UTSW 9 66753726 missense probably damaging 1.00
R3710:Car12 UTSW 9 66750978 missense probably damaging 1.00
R3872:Car12 UTSW 9 66717552 splice site probably benign
R3875:Car12 UTSW 9 66717552 splice site probably benign
R4898:Car12 UTSW 9 66764318 nonsense probably null
R5046:Car12 UTSW 9 66746613 missense probably benign
R6788:Car12 UTSW 9 66751962 missense probably damaging 0.98
R7105:Car12 UTSW 9 66752406 missense probably damaging 1.00
R7231:Car12 UTSW 9 66752317 missense probably damaging 0.99
R7380:Car12 UTSW 9 66747663 missense probably benign 0.03
X0019:Car12 UTSW 9 66751957 missense probably damaging 1.00
Z1177:Car12 UTSW 9 66751954 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGTACCTAGTGAGACCCTCAG -3'
(R):5'- TCAGCCAGTCTCCAAAGGAC -3'

Sequencing Primer
(F):5'- CCTAGTGAGACCCTCAGAATAATGG -3'
(R):5'- CCAAAGGACACTGTTTCCTTAGTAGG -3'
Posted On2018-02-28