Incidental Mutation 'R6238:Raet1e'
ID505061
Institutional Source Beutler Lab
Gene Symbol Raet1e
Ensembl Gene ENSMUSG00000053219
Gene Nameretinoic acid early transcript 1E
SynonymsRae-1 epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22158569-22374139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22180871 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 115 (N115K)
Ref Sequence ENSEMBL: ENSMUSP00000138022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065527] [ENSMUST00000105522] [ENSMUST00000178026] [ENSMUST00000180648] [ENSMUST00000181645]
Predicted Effect probably benign
Transcript: ENSMUST00000065527
AA Change: N115K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066627
Gene: ENSMUSG00000053219
AA Change: N115K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105522
SMART Domains Protein: ENSMUSP00000101161
Gene: ENSMUSG00000075297

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G59|B 29 195 2e-9 PDB
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178026
AA Change: N115K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219
AA Change: N115K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180648
SMART Domains Protein: ENSMUSP00000137946
Gene: ENSMUSG00000053219

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 66 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181645
AA Change: N115K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138022
Gene: ENSMUSG00000053219
AA Change: N115K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Raet1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Raet1e APN 10 22181320 missense probably damaging 1.00
IGL02406:Raet1e APN 10 22180636 missense probably damaging 1.00
IGL02484:Raet1e APN 10 22180767 missense probably benign 0.01
R0049:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0239:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0639:Raet1e UTSW 10 22174375 missense probably damaging 0.99
R0885:Raet1e UTSW 10 22182087 unclassified probably benign
R3704:Raet1e UTSW 10 22180845 missense probably benign 0.20
R4764:Raet1e UTSW 10 22181332 missense probably damaging 1.00
R4799:Raet1e UTSW 10 22181300 missense probably damaging 1.00
R5566:Raet1e UTSW 10 22174405 missense probably damaging 1.00
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6077:Raet1e UTSW 10 22181988 missense possibly damaging 0.72
R6408:Raet1e UTSW 10 22180746 missense probably benign 0.29
R6939:Raet1e UTSW 10 22174357 missense possibly damaging 0.86
R7147:Raet1e UTSW 10 22181280 missense probably benign 0.29
Z1088:Raet1e UTSW 10 22181951 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACGTGAAGTGCTCAGTGGATG -3'
(R):5'- CTGATCAGTCCATCACCTCAAGTC -3'

Sequencing Primer
(F):5'- GTGCTCAGTGGATGAAATAACTATCC -3'
(R):5'- ATCACCTCAAGTCTTTCTATACAAGC -3'
Posted On2018-02-28