Incidental Mutation 'R6238:Tsen54'
ID505067
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115820687 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 310 (R310H)
Ref Sequence ENSEMBL: ENSMUSP00000102090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000103032] [ENSMUST00000106481] [ENSMUST00000133250] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000177736]
Predicted Effect probably benign
Transcript: ENSMUST00000021134
AA Change: R310H

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781
AA Change: R310H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106481
AA Change: R310H

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781
AA Change: R310H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128266
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136343
AA Change: R154H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781
AA Change: R154H

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141748
Predicted Effect probably benign
Transcript: ENSMUST00000154304
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000157061
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
PIT4486001:Tsen54 UTSW 11 115822596 missense probably damaging 1.00
R0179:Tsen54 UTSW 11 115822030 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R2300:Tsen54 UTSW 11 115822078 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4521:Tsen54 UTSW 11 115817106 critical splice donor site probably null
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6459:Tsen54 UTSW 11 115821680 missense probably damaging 1.00
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Z1176:Tsen54 UTSW 11 115820578 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTGACCAGAGTAGCCAATACCC -3'
(R):5'- TAACATCCTCCCGGAACTGC -3'

Sequencing Primer
(F):5'- GTCTCAGGACTCAAGCCCCAG -3'
(R):5'- AACTGCTGGACCACTGCTTG -3'
Posted On2018-02-28