Incidental Mutation 'R6238:Cenpo'
ID505068
Institutional Source Beutler Lab
Gene Symbol Cenpo
Ensembl Gene ENSMUSG00000020652
Gene Namecentromere protein O
Synonyms2810429O05Rik, 8430427C03Rik, D12Ertd482e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6238 (G1)
Quality Score170.009
Status Validated
Chromosome12
Chromosomal Location4196004-4234294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4231968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 10 (S10C)
Ref Sequence ENSEMBL: ENSMUSP00000121258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000111169] [ENSMUST00000128466] [ENSMUST00000140975] [ENSMUST00000179139]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126017
Predicted Effect possibly damaging
Transcript: ENSMUST00000128466
AA Change: S10C

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121258
Gene: ENSMUSG00000020652
AA Change: S10C

DomainStartEndE-ValueType
coiled coil region 40 75 N/A INTRINSIC
Pfam:CENP-O 119 196 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179139
SMART Domains Protein: ENSMUSP00000137070
Gene: ENSMUSG00000096199

DomainStartEndE-ValueType
Pfam:PTH2 25 139 2.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219991
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Cenpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Cenpo APN 12 4216685 missense probably benign 0.02
IGL01661:Cenpo APN 12 4234023 unclassified probably null
IGL02716:Cenpo APN 12 4215390 missense possibly damaging 0.90
R0305:Cenpo UTSW 12 4216660 missense possibly damaging 0.48
R0811:Cenpo UTSW 12 4216643 missense probably benign 0.06
R0812:Cenpo UTSW 12 4216643 missense probably benign 0.06
R1574:Cenpo UTSW 12 4215433 splice site probably null
R1574:Cenpo UTSW 12 4215433 splice site probably null
R1916:Cenpo UTSW 12 4216683 missense probably benign 0.05
R2174:Cenpo UTSW 12 4217318 missense probably benign 0.00
R5384:Cenpo UTSW 12 4216646 missense probably damaging 1.00
R6211:Cenpo UTSW 12 4216733 missense probably benign 0.22
R6630:Cenpo UTSW 12 4217236 unclassified probably benign
R6862:Cenpo UTSW 12 4216539 missense probably damaging 1.00
R7086:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7087:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7088:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7351:Cenpo UTSW 12 4216581 missense probably damaging 0.99
R7790:Cenpo UTSW 12 4214597 missense probably benign 0.00
R7877:Cenpo UTSW 12 4214573 missense probably damaging 1.00
R7960:Cenpo UTSW 12 4214573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAAGCATACTCCACG -3'
(R):5'- CCAGCAGAGAGGTTAATGGTCTC -3'

Sequencing Primer
(F):5'- TGCTGTGCTAAACGCTGAC -3'
(R):5'- ATCTCTGTGAGTTCAAGGACAGCC -3'
Posted On2018-02-28