Incidental Mutation 'R6238:Dennd6a'
ID505077
Institutional Source Beutler Lab
Gene Symbol Dennd6a
Ensembl Gene ENSMUSG00000040818
Gene NameDENN/MADD domain containing 6A
SynonymsA630054L15Rik, Fam116a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26573856-26634322 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 26616658 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037585] [ENSMUST00000037585] [ENSMUST00000203874] [ENSMUST00000203874] [ENSMUST00000224111] [ENSMUST00000224111] [ENSMUST00000224248] [ENSMUST00000224248] [ENSMUST00000224378] [ENSMUST00000224378]
Predicted Effect probably null
Transcript: ENSMUST00000037585
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037585
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203874
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203874
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224111
Predicted Effect probably null
Transcript: ENSMUST00000224111
Predicted Effect probably null
Transcript: ENSMUST00000224248
Predicted Effect probably null
Transcript: ENSMUST00000224248
Predicted Effect probably null
Transcript: ENSMUST00000224378
Predicted Effect probably null
Transcript: ENSMUST00000224378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225206
Meta Mutation Damage Score 0.9472 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Dennd6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dennd6a APN 14 26608613 missense probably damaging 1.00
IGL01011:Dennd6a APN 14 26603054 missense probably damaging 0.99
IGL01395:Dennd6a APN 14 26616901 nonsense probably null
IGL01559:Dennd6a APN 14 26608565 missense probably damaging 1.00
IGL01590:Dennd6a APN 14 26619352 missense probably benign 0.40
IGL02187:Dennd6a APN 14 26606926 missense probably benign
IGL03296:Dennd6a APN 14 26616960 critical splice donor site probably null
R1831:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R1833:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R2020:Dennd6a UTSW 14 26612003 missense probably damaging 0.99
R2032:Dennd6a UTSW 14 26604749 missense probably benign 0.42
R2036:Dennd6a UTSW 14 26608119 missense probably damaging 0.99
R3707:Dennd6a UTSW 14 26592391 splice site probably benign
R4112:Dennd6a UTSW 14 26628518 intron probably benign
R4728:Dennd6a UTSW 14 26627420 missense probably null 1.00
R5053:Dennd6a UTSW 14 26608583 missense probably damaging 1.00
R5760:Dennd6a UTSW 14 26612040 missense probably damaging 0.99
R5774:Dennd6a UTSW 14 26579819 missense probably benign
R5775:Dennd6a UTSW 14 26619373 nonsense probably null
R6446:Dennd6a UTSW 14 26629534 missense probably damaging 1.00
R6734:Dennd6a UTSW 14 26608619 missense possibly damaging 0.84
R7289:Dennd6a UTSW 14 26612038 missense probably damaging 1.00
R7436:Dennd6a UTSW 14 26579710 nonsense probably null
R7887:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
R7970:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
RF003:Dennd6a UTSW 14 26629534 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGAGTGAGCGGAGTTGAC -3'
(R):5'- AGCCAACAACCTAGGTGAGTATATAC -3'

Sequencing Primer
(F):5'- GAGCAGAGGTCCTAAAATTCAGTTCC -3'
(R):5'- GATTGTGCAAGCCACACT -3'
Posted On2018-02-28