Incidental Mutation 'R6238:Plcl2'
ID505084
Institutional Source Beutler Lab
Gene Symbol Plcl2
Ensembl Gene ENSMUSG00000038910
Gene Namephospholipase C-like 2
SynonymsPRIP-2, Plce2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6238 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location50509547-50688493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50606845 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 294 (V294A)
Ref Sequence ENSEMBL: ENSMUSP00000046584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043938]
Predicted Effect probably damaging
Transcript: ENSMUST00000043938
AA Change: V294A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: V294A

DomainStartEndE-ValueType
low complexity region 20 49 N/A INTRINSIC
PH 143 254 2.88e-5 SMART
Pfam:EF-hand_like 344 426 3.7e-29 PFAM
PLCXc 427 571 2.19e-84 SMART
PLCYc 619 735 4.37e-61 SMART
C2 756 862 3.45e-19 SMART
Meta Mutation Damage Score 0.2289 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A C 10: 76,449,262 T2P possibly damaging Het
2610042L04Rik A G 14: 4,348,962 N41S probably damaging Het
4933402N03Rik T C 7: 131,146,134 D43G probably benign Het
Adcy10 C A 1: 165,575,728 Y1598* probably null Het
Adgrv1 G A 13: 81,466,283 T3997M probably benign Het
Amfr A C 8: 94,000,364 F74V probably damaging Het
Ankrd13a T C 5: 114,786,726 Y91H probably benign Het
Baiap3 A G 17: 25,245,758 S767P probably benign Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Casp9 G T 4: 141,807,137 G286V probably damaging Het
Cc2d2a T A 5: 43,671,235 D18E probably benign Het
Cdc27 T C 11: 104,528,444 N221D probably damaging Het
Cebpz A G 17: 78,936,910 S41P possibly damaging Het
Cenpo T A 12: 4,231,968 S10C possibly damaging Het
Chid1 A G 7: 141,496,136 V368A probably benign Het
Clca1 C A 3: 145,008,955 V634L probably benign Het
Cmtr1 A G 17: 29,682,148 D683G probably damaging Het
Cpsf3 G T 12: 21,300,162 R294L probably damaging Het
Ddrgk1 G A 2: 130,654,679 T255M possibly damaging Het
Dennd6a T A 14: 26,616,658 probably null Het
Dnah10 A G 5: 124,743,679 R526G probably damaging Het
Dock3 G A 9: 106,912,948 T1484I probably benign Het
Efcab10 T C 12: 33,398,434 Y89H probably damaging Het
Etl4 T A 2: 20,801,568 D1200E probably damaging Het
Fbn1 T A 2: 125,324,945 D2017V probably damaging Het
Ftmt G A 18: 52,332,235 V208M probably damaging Het
Fzd10 T C 5: 128,602,931 Y572H probably damaging Het
Gcc1 T C 6: 28,420,743 K39E probably damaging Het
Hydin A G 8: 110,392,111 probably null Het
Lif A G 11: 4,268,940 E73G possibly damaging Het
Lrtm1 C A 14: 29,027,671 Q357K probably benign Het
Mef2d T A 3: 88,159,545 L205Q probably damaging Het
Naalad2 T A 9: 18,385,065 E96D probably damaging Het
Nbas T C 12: 13,482,595 I1768T probably benign Het
Nodal T C 10: 61,423,479 S232P probably damaging Het
Olfr598 A T 7: 103,328,908 I141F possibly damaging Het
Olfr876 A G 9: 37,804,021 T37A probably benign Het
Parl G A 16: 20,302,213 R39C possibly damaging Het
Pcdha9 G A 18: 36,998,975 V366I probably benign Het
Pdzd8 A G 19: 59,300,562 V802A probably benign Het
Plxna2 T A 1: 194,790,196 S1083T probably benign Het
Polr2a G T 11: 69,747,221 L141I possibly damaging Het
Ptpre C A 7: 135,671,180 R468S probably damaging Het
Raet1e T A 10: 22,180,871 N115K probably benign Het
Rfx8 C A 1: 39,670,394 S491I probably damaging Het
Rpe T A 1: 66,701,648 L48* probably null Het
Skint5 A T 4: 113,942,867 probably null Het
Spata24 C A 18: 35,660,336 S111I possibly damaging Het
Suz12 G C 11: 80,002,180 probably benign Het
Taf4 T A 2: 179,932,039 I679F probably damaging Het
Tlr1 G T 5: 64,927,129 P35Q possibly damaging Het
Tonsl T C 15: 76,636,218 probably null Het
Tsen54 G A 11: 115,820,687 R310H probably benign Het
Ttc7b A G 12: 100,495,422 S99P probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uhmk1 T A 1: 170,199,994 N378I probably damaging Het
Vmn2r107 A G 17: 20,345,587 T55A probably benign Het
Vmn2r74 C T 7: 85,952,072 C786Y probably damaging Het
Wdr20rt C T 12: 65,226,190 probably benign Het
Zfand2a T A 5: 139,481,991 H42L probably damaging Het
Zfp990 T A 4: 145,537,913 C494S probably damaging Het
Zkscan4 A T 13: 21,484,587 R403W possibly damaging Het
Other mutations in Plcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Plcl2 APN 17 50606920 missense probably benign 0.01
IGL01746:Plcl2 APN 17 50607696 missense probably benign 0.00
IGL02227:Plcl2 APN 17 50606397 missense probably damaging 0.97
IGL02232:Plcl2 APN 17 50606641 missense possibly damaging 0.66
IGL02878:Plcl2 APN 17 50607355 missense probably damaging 1.00
IGL02985:Plcl2 APN 17 50687814 nonsense probably null
Parece UTSW 17 50607846 missense probably damaging 0.99
verdad UTSW 17 50608081 missense probably damaging 1.00
IGL03014:Plcl2 UTSW 17 50611001 missense possibly damaging 0.65
R0110:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0190:Plcl2 UTSW 17 50607643 missense probably benign
R0280:Plcl2 UTSW 17 50607034 missense probably damaging 1.00
R0414:Plcl2 UTSW 17 50607955 missense possibly damaging 0.90
R0450:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0760:Plcl2 UTSW 17 50608774 missense possibly damaging 0.82
R1134:Plcl2 UTSW 17 50608110 missense probably benign
R1168:Plcl2 UTSW 17 50607072 missense possibly damaging 0.49
R1381:Plcl2 UTSW 17 50607729 missense probably damaging 0.99
R1748:Plcl2 UTSW 17 50606798 missense probably benign
R1856:Plcl2 UTSW 17 50607850 missense probably benign 0.13
R1958:Plcl2 UTSW 17 50608081 missense probably damaging 1.00
R2016:Plcl2 UTSW 17 50606694 missense probably damaging 1.00
R2057:Plcl2 UTSW 17 50668111 splice site probably null
R2077:Plcl2 UTSW 17 50606829 missense probably benign
R2247:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R3083:Plcl2 UTSW 17 50687744 missense probably benign 0.06
R4153:Plcl2 UTSW 17 50606361 nonsense probably null
R4574:Plcl2 UTSW 17 50607846 missense probably damaging 0.99
R4870:Plcl2 UTSW 17 50607226 missense possibly damaging 0.46
R5030:Plcl2 UTSW 17 50607319 missense possibly damaging 0.92
R5330:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5331:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5503:Plcl2 UTSW 17 50509929 missense probably benign 0.00
R5920:Plcl2 UTSW 17 50608675 missense probably damaging 0.99
R6378:Plcl2 UTSW 17 50668160 intron probably null
R6603:Plcl2 UTSW 17 50607117 missense probably benign 0.03
R6633:Plcl2 UTSW 17 50640140 missense probably benign 0.00
R7113:Plcl2 UTSW 17 50606464 missense probably damaging 1.00
R7466:Plcl2 UTSW 17 50608468 missense probably damaging 1.00
R7665:Plcl2 UTSW 17 50607157 missense probably benign 0.00
X0026:Plcl2 UTSW 17 50607560 missense probably benign 0.03
Z1088:Plcl2 UTSW 17 50606992 missense probably damaging 1.00
Z1176:Plcl2 UTSW 17 50608456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCAAACATCTGGGTGAC -3'
(R):5'- CCCTGTTCTGCCTCAAGAAAC -3'

Sequencing Primer
(F):5'- TGACAGGACTCCGCTACC -3'
(R):5'- CTCAAGAAACATCATAAGGTCCTTGG -3'
Posted On2018-02-28