Incidental Mutation 'R6239:Acsl3'
ID505092
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R6239 (G1)
Quality Score213.009
Status Validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78696465 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 373 (S373T)
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
AA Change: S373T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: S373T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132997
Predicted Effect probably benign
Transcript: ENSMUST00000134566
AA Change: S221T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: S221T

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
AA Change: S373T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: S373T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154777
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCACCACAGACATTAGCAG -3'
(R):5'- CCAACTGTTGTCTATGTGATATAGGAC -3'

Sequencing Primer
(F):5'- GCAGATCAGGTAAATCACATATCTGC -3'
(R):5'- TGACCTCACTGGCAAGATATG -3'
Posted On2018-02-28