Incidental Mutation 'R6239:Slc13a3'
ID505101
Institutional Source Beutler Lab
Gene Symbol Slc13a3
Ensembl Gene ENSMUSG00000018459
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
SynonymsSDCT2, NaDC-3, NaDC3
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6239 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165405028-165473230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165406697 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 554 (T554A)
Ref Sequence ENSEMBL: ENSMUSP00000104902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]
Predicted Effect unknown
Transcript: ENSMUST00000029208
AA Change: T596A
SMART Domains Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: T596A

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 571 2.6e-110 PFAM
Pfam:CitMHS 43 167 1.4e-15 PFAM
Pfam:CitMHS 221 486 5.3e-18 PFAM
low complexity region 578 596 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109279
AA Change: T554A
SMART Domains Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459
AA Change: T554A

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 270 6.7e-49 PFAM
Pfam:Na_sulph_symp 265 529 1.9e-51 PFAM
low complexity region 536 554 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145513
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Slc13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc13a3 APN 2 165411923 missense probably damaging 1.00
IGL00326:Slc13a3 APN 2 165473097 missense possibly damaging 0.89
IGL01308:Slc13a3 APN 2 165406780 missense probably damaging 0.99
IGL01668:Slc13a3 APN 2 165430292 missense probably damaging 1.00
IGL02435:Slc13a3 APN 2 165408940 missense possibly damaging 0.95
IGL02551:Slc13a3 APN 2 165424573 missense probably damaging 1.00
IGL02716:Slc13a3 APN 2 165406715 missense unknown
IGL03107:Slc13a3 APN 2 165437307 missense probably benign 0.00
R0114:Slc13a3 UTSW 2 165424581 missense probably damaging 1.00
R0624:Slc13a3 UTSW 2 165411887 missense probably damaging 1.00
R1051:Slc13a3 UTSW 2 165408820 critical splice donor site probably null
R1780:Slc13a3 UTSW 2 165406699 missense unknown
R1782:Slc13a3 UTSW 2 165445519 missense probably benign 0.01
R1994:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R4739:Slc13a3 UTSW 2 165430289 missense possibly damaging 0.91
R4971:Slc13a3 UTSW 2 165448699 missense probably damaging 0.99
R5091:Slc13a3 UTSW 2 165420080 missense probably benign 0.11
R5093:Slc13a3 UTSW 2 165411896 missense probably damaging 1.00
R5826:Slc13a3 UTSW 2 165408956 missense probably benign 0.05
R5894:Slc13a3 UTSW 2 165424623 missense probably benign 0.00
R6394:Slc13a3 UTSW 2 165434097 missense probably damaging 1.00
R6453:Slc13a3 UTSW 2 165411947 missense possibly damaging 0.94
R6463:Slc13a3 UTSW 2 165445653 missense probably damaging 1.00
R6480:Slc13a3 UTSW 2 165408898 missense probably damaging 1.00
R6525:Slc13a3 UTSW 2 165406747 missense unknown
R6879:Slc13a3 UTSW 2 165430301 missense probably damaging 1.00
R7278:Slc13a3 UTSW 2 165445528 missense possibly damaging 0.87
R7340:Slc13a3 UTSW 2 165430290 missense probably benign 0.00
R7404:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R7452:Slc13a3 UTSW 2 165427114 missense probably benign 0.03
R7585:Slc13a3 UTSW 2 165430322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGAAACCACTGGAGGATG -3'
(R):5'- TGAGCCTGCAACTTCCATCTG -3'

Sequencing Primer
(F):5'- AGGATGTCCTTGCTTGCTGC -3'
(R):5'- GCAACTTCCATCTGCTCTGAAGG -3'
Posted On2018-02-28