Incidental Mutation 'R6239:Flg2'
ID505102
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6239 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93201272 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 202 (E202D)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect probably benign
Transcript: ENSMUST00000098884
AA Change: E202D

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: E202D

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATGGACATAGTTCTGGGG -3'
(R):5'- GTCTGCAACATCCACTAGAATTGC -3'

Sequencing Primer
(F):5'- ACATAGTTCTGGGGGCTCAC -3'
(R):5'- CTGAACTTGAAGTATTATACCCAAGC -3'
Posted On2018-02-28