Incidental Mutation 'R6239:Cyp2t4'
ID505116
Institutional Source Beutler Lab
Gene Symbol Cyp2t4
Ensembl Gene ENSMUSG00000078787
Gene Namecytochrome P450, family 2, subfamily t, polypeptide 4
SynonymsLOC384724
MMRRC Submission 044363-MU
Accession Numbers

Genbank: NM_001100184; MGI: 2686296

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6239 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27153714-27158668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27157475 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 280 (Q280L)
Ref Sequence ENSEMBL: ENSMUSP00000104022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000108382] [ENSMUST00000108385] [ENSMUST00000164093]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108385
AA Change: Q280L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104022
Gene: ENSMUSG00000078787
AA Change: Q280L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 35 492 5.3e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect probably benign
Transcript: ENSMUST00000164093
AA Change: Q288L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126779
Gene: ENSMUSG00000078787
AA Change: Q288L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:p450 43 500 2.6e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Cyp2t4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2t4 APN 7 27155298 missense probably benign 0.00
IGL00706:Cyp2t4 APN 7 27155158 missense probably benign 0.01
IGL02926:Cyp2t4 APN 7 27157803 missense probably damaging 1.00
R0560:Cyp2t4 UTSW 7 27158511 missense probably damaging 0.99
R0632:Cyp2t4 UTSW 7 27158246 missense possibly damaging 0.82
R0788:Cyp2t4 UTSW 7 27155163 missense probably null
R1353:Cyp2t4 UTSW 7 27156630 missense probably benign 0.03
R1652:Cyp2t4 UTSW 7 27157390 missense possibly damaging 0.48
R1838:Cyp2t4 UTSW 7 27158416 missense possibly damaging 0.92
R1997:Cyp2t4 UTSW 7 27157613 critical splice donor site probably null
R2136:Cyp2t4 UTSW 7 27158160 missense probably benign 0.32
R2963:Cyp2t4 UTSW 7 27155274 missense possibly damaging 0.86
R6634:Cyp2t4 UTSW 7 27155788 nonsense probably null
R7251:Cyp2t4 UTSW 7 27157719 missense possibly damaging 0.72
R7348:Cyp2t4 UTSW 7 27157251 missense probably benign 0.01
R7436:Cyp2t4 UTSW 7 27158243 missense probably damaging 0.99
R8350:Cyp2t4 UTSW 7 27157381 missense possibly damaging 0.51
R8352:Cyp2t4 UTSW 7 27157737 missense probably benign 0.04
Z1088:Cyp2t4 UTSW 7 27157746 missense probably damaging 1.00
Z1177:Cyp2t4 UTSW 7 27158240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGAGCTCCGACTCTTC -3'
(R):5'- TTTACTGAGATCCCACCCCAG -3'

Sequencing Primer
(F):5'- CATCTCTGAGCAAATTCAGTGGC -3'
(R):5'- CCTCTCTTCACTTAGGGGGAG -3'
Posted On2018-02-28