Incidental Mutation 'R6239:Trappc11'
ID505123
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6239 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47529494 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 70 (T70M)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033973] [ENSMUST00000039061] [ENSMUST00000175692] [ENSMUST00000176379]
Predicted Effect probably benign
Transcript: ENSMUST00000033973
SMART Domains Protein: ENSMUSP00000033973
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
low complexity region 131 153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039061
AA Change: T70M

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: T70M

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131551
Predicted Effect probably benign
Transcript: ENSMUST00000175692
Predicted Effect probably benign
Transcript: ENSMUST00000176379
SMART Domains Protein: ENSMUSP00000135059
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Snw1 A T 12: 87,464,628 N84K probably damaging Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 unclassified probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 intron probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 intron probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTGAGCAGACCCTTGCAAG -3'
(R):5'- CCTCTCATGGGAAGTGTAGTG -3'

Sequencing Primer
(F):5'- TTGCAAGCCCCGCTGTG -3'
(R):5'- GTGGGGTTGAGGTTCCACTC -3'
Posted On2018-02-28