Mutagenetix > Incidental Mutations

Incidental Mutation 'R6239:Eml6'

505132

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

MMRRC Submission

044363-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R6239 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29749275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1826 (D1826G)

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000078830] [ENSMUST00000137689]

AlphaFold

Q5SQM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000058902
AA Change: D1826G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: D1826G

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078830

SMART Domains

Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
low complexity region	60	77	N/A	INTRINSIC
low complexity region	85	100	N/A	INTRINSIC
low complexity region	109	129	N/A	INTRINSIC
low complexity region	134	160	N/A	INTRINSIC
Pfam:Reticulon	169	339	4.2e-58	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137017

Predicted Effect

probably benign
Transcript: ENSMUST00000137689

SMART Domains

Protein: ENSMUSP00000116197
Gene: ENSMUSG00000044072

Domain	Start	End	E-Value	Type
SCOP:d2bbkh_	14	72	9e-8	SMART
Blast:WD40	22	64	1e-24	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142651

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	T	A	1: 78,696,465	S373T	probably benign	Het
Aox2	G	A	1: 58,305,391		probably null	Het
Apol7c	T	C	15: 77,526,431	E105G	probably benign	Het
B4galnt2	C	T	11: 95,876,239	A184T	probably damaging	Het
Casz1	A	G	4: 148,938,277	Q600R	probably damaging	Het
Cep152	A	T	2: 125,579,412	S1133T	probably benign	Het
Cep295	T	C	9: 15,322,631	I2290V	possibly damaging	Het
Clmn	A	T	12: 104,780,845	H814Q	probably benign	Het
Creb3l1	A	G	2: 91,995,403	C124R	probably damaging	Het
Cspg4	A	G	9: 56,888,182	D1067G	probably benign	Het
Cyp1a1	T	A	9: 57,702,078	V354E	probably benign	Het
Cyp2t4	A	T	7: 27,157,475	Q280L	possibly damaging	Het
Dcaf6	A	T	1: 165,351,270	D563E	possibly damaging	Het
Dennd2a	A	G	6: 39,488,816	F607L	probably damaging	Het
Dennd2d	T	A	3: 106,494,877	F288I	probably damaging	Het
Dnah8	C	T	17: 30,810,359	R4101C	probably damaging	Het
Dnase2a	G	T	8: 84,908,879		probably null	Het
Dnmbp	C	T	19: 43,848,185	V1235I	probably benign	Het
Dusp27	A	T	1: 166,098,819	S1075T	probably damaging	Het
Fam186b	T	C	15: 99,280,434	Y337C	probably benign	Het
Flg2	A	T	3: 93,201,272	E202D	probably benign	Het
Fus	C	T	7: 127,981,434	R228C	possibly damaging	Het
Gatsl3	A	G	11: 4,218,967	T45A	possibly damaging	Het
Gbf1	A	G	19: 46,259,696	E304G	probably benign	Het
Ggt1	A	G	10: 75,585,681		probably null	Het
Gm19410	A	T	8: 35,778,764	D354V	probably damaging	Het
Hdac4	T	C	1: 92,054,972	D8G	probably benign	Het
Hhat	A	T	1: 192,595,087	Y355N	probably damaging	Het
Ift140	T	C	17: 25,028,972	V268A	probably benign	Het
Il4i1	A	G	7: 44,840,412	R542G	probably benign	Het
Itga2b	C	T	11: 102,465,318	V328I	possibly damaging	Het
Kmt2a	T	C	9: 44,819,796		probably benign	Het
Lrit3	A	T	3: 129,800,346	I194N	probably damaging	Het
Mast4	A	G	13: 102,736,209	L2025P	probably benign	Het
Neb	T	C	2: 52,273,988	N1986S	probably benign	Het
Osbpl7	G	A	11: 97,052,824		probably null	Het
Pabpc2	T	A	18: 39,773,838	L52Q	probably damaging	Het
Pald1	T	C	10: 61,321,131	S847G	possibly damaging	Het
Pcdh12	T	C	18: 38,282,401	D557G	probably damaging	Het
Prmt2	A	T	10: 76,222,591	L128*	probably null	Het
Ptpn3	C	A	4: 57,249,981	A172S	probably benign	Het
Ptpro	A	T	6: 137,380,608	T366S	probably benign	Het
Reg4	A	G	3: 98,231,284	K100R	probably null	Het
Rims2	A	T	15: 39,198,363	M1L	unknown	Het
Sele	A	G	1: 164,050,808	S239G	probably damaging	Het
Slc11a1	G	A	1: 74,384,115	R375Q	possibly damaging	Het
Slc13a3	T	C	2: 165,406,697	T554A	unknown	Het
Snw1	A	T	12: 87,464,628	N84K	probably damaging	Het
Stpg4	T	C	17: 87,411,239	Y171C	probably benign	Het
Tmem222	T	A	4: 133,268,295	H147L	probably damaging	Het
Tmprss11f	G	T	5: 86,533,777	R206S	probably damaging	Het
Trappc11	G	A	8: 47,529,494	T70M	possibly damaging	Het
Trpv4	G	A	5: 114,644,826	T25I	probably benign	Het
Ttr	T	C	18: 20,673,635	V114A	possibly damaging	Het
Umod	C	T	7: 119,477,297	C82Y	probably damaging	Het
Upk3a	T	A	15: 85,021,314	M208K	probably damaging	Het
Vmn1r59	G	A	7: 5,454,540	P74S	probably damaging	Het
Vwa3a	A	T	7: 120,794,234	R851S	probably benign	Het
Wdr78	A	C	4: 103,066,443	N396K	probably benign	Het
Zfp236	G	T	18: 82,657,104	T421K	possibly damaging	Het
Zswim9	C	A	7: 13,261,331	G300*	probably null	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
PIT4453001:Eml6	UTSW	11	29802489	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0766:Eml6	UTSW	11	29831219	splice site	probably benign
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6326:Eml6	UTSW	11	29819066	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6753:Eml6	UTSW	11	29754987	missense	probably damaging	1.00
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGTGACTGGGGATATGTTCC -3'
(R):5'- AGATCTGCCTCCTCATGGAC -3'

Sequencing Primer
(F):5'- TCTTACGAAAAGACTTGTACACACAG -3'
(R):5'- ATGGACCTTGCTTTTGATTTCC -3'

Posted On

2018-02-28