Incidental Mutation 'R6239:Snw1'
ID505136
Institutional Source Beutler Lab
Gene Symbol Snw1
Ensembl Gene ENSMUSG00000021039
Gene NameSNW domain containing 1
SynonymsSkiip, SKIP, NCoA-62, 2310008B08Rik, SNW1
MMRRC Submission 044363-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6239 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87449075-87472274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87464628 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 84 (N84K)
Ref Sequence ENSEMBL: ENSMUSP00000021428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021428]
Predicted Effect probably damaging
Transcript: ENSMUST00000021428
AA Change: N84K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021428
Gene: ENSMUSG00000021039
AA Change: N84K

DomainStartEndE-ValueType
Pfam:SKIP_SNW 175 335 2e-78 PFAM
low complexity region 524 536 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T A 1: 78,696,465 S373T probably benign Het
Aox2 G A 1: 58,305,391 probably null Het
Apol7c T C 15: 77,526,431 E105G probably benign Het
B4galnt2 C T 11: 95,876,239 A184T probably damaging Het
Casz1 A G 4: 148,938,277 Q600R probably damaging Het
Cep152 A T 2: 125,579,412 S1133T probably benign Het
Cep295 T C 9: 15,322,631 I2290V possibly damaging Het
Clmn A T 12: 104,780,845 H814Q probably benign Het
Creb3l1 A G 2: 91,995,403 C124R probably damaging Het
Cspg4 A G 9: 56,888,182 D1067G probably benign Het
Cyp1a1 T A 9: 57,702,078 V354E probably benign Het
Cyp2t4 A T 7: 27,157,475 Q280L possibly damaging Het
Dcaf6 A T 1: 165,351,270 D563E possibly damaging Het
Dennd2a A G 6: 39,488,816 F607L probably damaging Het
Dennd2d T A 3: 106,494,877 F288I probably damaging Het
Dnah8 C T 17: 30,810,359 R4101C probably damaging Het
Dnase2a G T 8: 84,908,879 probably null Het
Dnmbp C T 19: 43,848,185 V1235I probably benign Het
Dusp27 A T 1: 166,098,819 S1075T probably damaging Het
Eml6 T C 11: 29,749,275 D1826G probably damaging Het
Fam186b T C 15: 99,280,434 Y337C probably benign Het
Flg2 A T 3: 93,201,272 E202D probably benign Het
Fus C T 7: 127,981,434 R228C possibly damaging Het
Gatsl3 A G 11: 4,218,967 T45A possibly damaging Het
Gbf1 A G 19: 46,259,696 E304G probably benign Het
Ggt1 A G 10: 75,585,681 probably null Het
Gm19410 A T 8: 35,778,764 D354V probably damaging Het
Hdac4 T C 1: 92,054,972 D8G probably benign Het
Hhat A T 1: 192,595,087 Y355N probably damaging Het
Ift140 T C 17: 25,028,972 V268A probably benign Het
Il4i1 A G 7: 44,840,412 R542G probably benign Het
Itga2b C T 11: 102,465,318 V328I possibly damaging Het
Kmt2a T C 9: 44,819,796 probably benign Het
Lrit3 A T 3: 129,800,346 I194N probably damaging Het
Mast4 A G 13: 102,736,209 L2025P probably benign Het
Neb T C 2: 52,273,988 N1986S probably benign Het
Osbpl7 G A 11: 97,052,824 probably null Het
Pabpc2 T A 18: 39,773,838 L52Q probably damaging Het
Pald1 T C 10: 61,321,131 S847G possibly damaging Het
Pcdh12 T C 18: 38,282,401 D557G probably damaging Het
Prmt2 A T 10: 76,222,591 L128* probably null Het
Ptpn3 C A 4: 57,249,981 A172S probably benign Het
Ptpro A T 6: 137,380,608 T366S probably benign Het
Reg4 A G 3: 98,231,284 K100R probably null Het
Rims2 A T 15: 39,198,363 M1L unknown Het
Sele A G 1: 164,050,808 S239G probably damaging Het
Slc11a1 G A 1: 74,384,115 R375Q possibly damaging Het
Slc13a3 T C 2: 165,406,697 T554A unknown Het
Stpg4 T C 17: 87,411,239 Y171C probably benign Het
Tmem222 T A 4: 133,268,295 H147L probably damaging Het
Tmprss11f G T 5: 86,533,777 R206S probably damaging Het
Trappc11 G A 8: 47,529,494 T70M possibly damaging Het
Trpv4 G A 5: 114,644,826 T25I probably benign Het
Ttr T C 18: 20,673,635 V114A possibly damaging Het
Umod C T 7: 119,477,297 C82Y probably damaging Het
Upk3a T A 15: 85,021,314 M208K probably damaging Het
Vmn1r59 G A 7: 5,454,540 P74S probably damaging Het
Vwa3a A T 7: 120,794,234 R851S probably benign Het
Wdr78 A C 4: 103,066,443 N396K probably benign Het
Zfp236 G T 18: 82,657,104 T421K possibly damaging Het
Zswim9 C A 7: 13,261,331 G300* probably null Het
Other mutations in Snw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Snw1 APN 12 87452580 critical splice donor site probably null
IGL00559:Snw1 APN 12 87468731 missense probably damaging 0.98
IGL00561:Snw1 APN 12 87450804 critical splice donor site probably null
IGL01019:Snw1 APN 12 87450941 missense probably benign 0.24
IGL01304:Snw1 APN 12 87453915 missense possibly damaging 0.71
IGL01918:Snw1 APN 12 87455668 missense probably benign 0.14
IGL03170:Snw1 APN 12 87472252 missense probably benign 0.00
R0149:Snw1 UTSW 12 87461917 missense possibly damaging 0.51
R1760:Snw1 UTSW 12 87464689 missense probably benign 0.06
R1935:Snw1 UTSW 12 87459477 missense probably damaging 1.00
R2130:Snw1 UTSW 12 87452703 unclassified probably benign
R2230:Snw1 UTSW 12 87452658 missense probably benign 0.00
R2496:Snw1 UTSW 12 87450819 missense probably benign
R4907:Snw1 UTSW 12 87459489 missense probably benign 0.19
R4926:Snw1 UTSW 12 87452658 missense probably benign 0.00
R5138:Snw1 UTSW 12 87460435 missense probably benign 0.00
R5447:Snw1 UTSW 12 87455715 missense probably benign 0.19
R6552:Snw1 UTSW 12 87459419 critical splice donor site probably null
R6747:Snw1 UTSW 12 87464710 missense probably damaging 1.00
R7230:Snw1 UTSW 12 87464554 missense probably damaging 1.00
R7242:Snw1 UTSW 12 87468645 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAGTCCACAATGGCAAGTG -3'
(R):5'- GCCCACTAACTGCACAGATG -3'

Sequencing Primer
(F):5'- CACAATGGCAAGTGGCTTATC -3'
(R):5'- CAGATGAAAACCTTGCTGCTG -3'
Posted On2018-02-28