Incidental Mutation 'R6240:Arhgef18'
ID505172
Institutional Source Beutler Lab
Gene Symbol Arhgef18
Ensembl Gene ENSMUSG00000004568
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 18
SynonymsD030053O22Rik
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6240 (G1)
Quality Score219.009
Status Validated
Chromosome8
Chromosomal Location3393006-3456601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3439658 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 330 (R330Q)
Ref Sequence ENSEMBL: ENSMUSP00000004684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684]
Predicted Effect probably damaging
Transcript: ENSMUST00000004684
AA Change: R330Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568
AA Change: R330Q

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156085
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahi1 A G 10: 20,977,081 D516G probably damaging Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Arhgef18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Arhgef18 APN 8 3429553 missense probably damaging 1.00
IGL01649:Arhgef18 APN 8 3441211 splice site probably benign
IGL01736:Arhgef18 APN 8 3451624 splice site probably benign
IGL02206:Arhgef18 APN 8 3445034 missense probably benign 0.00
IGL02401:Arhgef18 APN 8 3437078 missense probably damaging 1.00
IGL02938:Arhgef18 APN 8 3450802 missense probably benign 0.02
IGL02943:Arhgef18 APN 8 3448553 missense probably damaging 0.99
IGL02990:Arhgef18 APN 8 3444904 missense probably benign 0.02
IGL03162:Arhgef18 APN 8 3441301 splice site probably null
R1622:Arhgef18 UTSW 8 3441272 missense possibly damaging 0.46
R1681:Arhgef18 UTSW 8 3439645 missense probably damaging 1.00
R1726:Arhgef18 UTSW 8 3454228 missense possibly damaging 0.46
R2126:Arhgef18 UTSW 8 3451939 missense probably damaging 0.99
R2161:Arhgef18 UTSW 8 3439575 nonsense probably null
R2878:Arhgef18 UTSW 8 3432759 missense probably benign
R3916:Arhgef18 UTSW 8 3454197 missense probably benign
R4231:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4233:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4234:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4235:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4236:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4450:Arhgef18 UTSW 8 3437097 missense probably damaging 0.97
R4539:Arhgef18 UTSW 8 3447070 missense probably benign
R4670:Arhgef18 UTSW 8 3434897 missense probably damaging 1.00
R4753:Arhgef18 UTSW 8 3444938 missense probably damaging 1.00
R4897:Arhgef18 UTSW 8 3444979 missense probably benign
R5313:Arhgef18 UTSW 8 3451629 critical splice acceptor site probably null
R5698:Arhgef18 UTSW 8 3439499 missense probably damaging 0.99
R5781:Arhgef18 UTSW 8 3439439 splice site probably null
R5851:Arhgef18 UTSW 8 3434980 missense probably damaging 1.00
R5897:Arhgef18 UTSW 8 3439682 missense probably damaging 1.00
R5908:Arhgef18 UTSW 8 3453165 missense probably damaging 1.00
R6123:Arhgef18 UTSW 8 3437091 missense probably damaging 0.99
R6136:Arhgef18 UTSW 8 3454507 missense probably benign
R6617:Arhgef18 UTSW 8 3439592 missense probably damaging 1.00
R7575:Arhgef18 UTSW 8 3451635 missense probably damaging 0.99
R7851:Arhgef18 UTSW 8 3448409 missense possibly damaging 0.46
R7947:Arhgef18 UTSW 8 3432775 missense probably damaging 1.00
R8030:Arhgef18 UTSW 8 3439600 missense probably damaging 1.00
X0021:Arhgef18 UTSW 8 3434942 missense probably damaging 1.00
Z1088:Arhgef18 UTSW 8 3439628 missense probably damaging 1.00
Z1176:Arhgef18 UTSW 8 3453224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGTAATGGGCACAAAACC -3'
(R):5'- TTCAAGAGGGAATGCCAATCC -3'

Sequencing Primer
(F):5'- TGCTTACACGTAACAGCTGG -3'
(R):5'- CCAATCCAAGATAGAGCTCTAAGGTG -3'
Posted On2018-02-28