Incidental Mutation 'R6240:Ahi1'
ID505184
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission 044364-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6240 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20977081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 516 (D516G)
Ref Sequence ENSEMBL: ENSMUSP00000101164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
Predicted Effect probably damaging
Transcript: ENSMUST00000105525
AA Change: D516G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: D516G

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: D516G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C A 14: 63,986,252 R25L probably damaging Het
9930021J03Rik A T 19: 29,717,240 S1618T probably benign Het
Adamts1 G A 16: 85,802,157 S185L probably benign Het
Adamts12 A T 15: 11,285,958 D751V probably benign Het
Adgrg3 A G 8: 95,039,916 D405G probably benign Het
Ahnak A T 19: 9,013,583 D4077V probably damaging Het
Arhgef18 G A 8: 3,439,658 R330Q probably damaging Het
Arid1a A G 4: 133,680,686 V2170A unknown Het
Asxl3 C T 18: 22,465,508 L227F probably damaging Het
B3glct A G 5: 149,726,788 I119V probably benign Het
Cad T A 5: 31,072,978 M1512K probably benign Het
Cdc25a A G 9: 109,884,158 T172A probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Clmp A G 9: 40,782,411 N308S probably damaging Het
Dlg5 A T 14: 24,149,528 probably null Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
E4f1 A G 17: 24,444,582 S524P possibly damaging Het
Epha5 G C 5: 84,117,579 A452G probably benign Het
Fzd3 T C 14: 65,209,855 T542A probably damaging Het
Glyctk A T 9: 106,156,262 probably null Het
Gm10382 G A 5: 125,389,596 probably benign Het
Gm8765 G A 13: 50,701,417 D364N probably damaging Het
Hnmt T A 2: 24,014,269 M127L probably benign Het
Hoxc10 T A 15: 102,970,830 W262R probably damaging Het
Icam5 T A 9: 21,033,158 W52R possibly damaging Het
Jazf1 A T 6: 52,777,552 C180S probably damaging Het
Kcnk2 A G 1: 189,242,982 W286R probably damaging Het
Kcnmb2 C T 3: 32,181,896 S98F probably damaging Het
Mob3a C G 10: 80,689,864 E204D possibly damaging Het
Morc3 C G 16: 93,862,684 H459D probably damaging Het
Mroh2b A T 15: 4,934,644 N876I probably benign Het
Myo16 A T 8: 10,370,930 T257S probably damaging Het
Nat1 A T 8: 67,491,702 R243S possibly damaging Het
Nudt9 T C 5: 104,047,089 V17A probably benign Het
Olfr1205 A G 2: 88,831,363 D82G probably benign Het
Olfr1216 A G 2: 89,013,626 I146T probably benign Het
Olfr1340 A G 4: 118,726,471 S75G probably benign Het
Olfr734 A G 14: 50,320,586 V83A probably benign Het
Olfr814 C A 10: 129,874,677 V27L probably benign Het
Pcdh7 T C 5: 57,721,362 L753P probably damaging Het
Pcf11 T A 7: 92,646,502 E1446D probably damaging Het
Pepd A G 7: 35,021,751 I267V probably benign Het
Plk2 T A 13: 110,399,474 Y571N probably damaging Het
Plk2 T A 13: 110,400,034 V620E probably damaging Het
Prag1 T C 8: 36,103,352 L363P probably benign Het
Psmd3 A G 11: 98,693,653 T387A probably damaging Het
Ptgs1 G A 2: 36,237,285 C61Y probably damaging Het
Rab18 T C 18: 6,784,635 Y109H probably benign Het
Robo2 G A 16: 73,982,139 P358L probably damaging Het
Smarcc2 C T 10: 128,488,024 probably benign Het
Srgap1 A G 10: 122,047,156 I13T probably benign Het
Tcf12 T A 9: 71,944,016 K110* probably null Het
Tdrd1 T C 19: 56,841,335 S214P probably benign Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Tmem255b A G 8: 13,454,216 Y136C probably damaging Het
Tmem63c A T 12: 87,076,405 I448F possibly damaging Het
Tnpo1 T C 13: 98,863,829 I335M probably damaging Het
Vmn1r1 T C 1: 182,157,621 T160A probably damaging Het
Vmn1r203 A G 13: 22,524,729 N227D possibly damaging Het
Vmn2r6 T A 3: 64,556,805 S203C probably damaging Het
Zfp628 A G 7: 4,919,849 T357A possibly damaging Het
Zfp872 A G 9: 22,199,884 K220E probably damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
arisen UTSW 10 21007768 missense possibly damaging 0.53
urspringt UTSW 10 20984393 missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R7999:Ahi1 UTSW 10 20965681 missense probably benign 0.31
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
R8248:Ahi1 UTSW 10 20972092 missense probably benign 0.04
R8560:Ahi1 UTSW 10 20959915 missense probably benign 0.04
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- CACAATGTGAGCAACTGAGAGTAC -3'
(R):5'- ACTGTTGTTAACCTGTCAGTGTGC -3'

Sequencing Primer
(F):5'- GCAAATGAAAAACAGTTCTTGAGTG -3'
(R):5'- CACGGTGCACAGCTATGATGTC -3'
Posted On2018-02-28