Incidental Mutation 'R6241:Tmx4'
ID505220
Institutional Source Beutler Lab
Gene Symbol Tmx4
Ensembl Gene ENSMUSG00000034723
Gene Namethioredoxin-related transmembrane protein 4
Synonyms2810417D04Rik, Txndc13, 4930500L08Rik, D2Bwg1356e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location134594185-134644145 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 134639505 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038228] [ENSMUST00000110119] [ENSMUST00000110120]
Predicted Effect probably benign
Transcript: ENSMUST00000038228
SMART Domains Protein: ENSMUSP00000045154
Gene: ENSMUSG00000034723

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 134 5.9e-14 PFAM
transmembrane domain 185 207 N/A INTRINSIC
low complexity region 241 255 N/A INTRINSIC
low complexity region 258 279 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110119
AA Change: C166Y
SMART Domains Protein: ENSMUSP00000105746
Gene: ENSMUSG00000034723
AA Change: C166Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 100 5.6e-11 PFAM
transmembrane domain 132 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110120
SMART Domains Protein: ENSMUSP00000105747
Gene: ENSMUSG00000034723

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 34 134 4.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137377
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and C-terminal ASP/GLU-rich calcium binding domain. Unlike most members of this gene family, it lacks a C-terminal ER-retention sequence. The encoded protein has been shown to have reductase activity in vitro. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Tmx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0033:Tmx4 UTSW 2 134600998 splice site probably null
R0124:Tmx4 UTSW 2 134639720 critical splice donor site probably null
R0311:Tmx4 UTSW 2 134598526 makesense probably null
R0844:Tmx4 UTSW 2 134600008 critical splice donor site probably null
R3804:Tmx4 UTSW 2 134620577 missense probably damaging 1.00
R3964:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R3966:Tmx4 UTSW 2 134600061 missense possibly damaging 0.81
R4296:Tmx4 UTSW 2 134598629 missense probably benign 0.00
R6011:Tmx4 UTSW 2 134639836 missense probably damaging 1.00
R6463:Tmx4 UTSW 2 134620639 missense probably damaging 0.98
R6810:Tmx4 UTSW 2 134620674 missense probably damaging 0.98
R6882:Tmx4 UTSW 2 134644002 missense possibly damaging 0.53
R6912:Tmx4 UTSW 2 134598799 missense probably benign 0.06
R7483:Tmx4 UTSW 2 134639661 missense probably benign 0.01
R7545:Tmx4 UTSW 2 134609505 missense possibly damaging 0.89
R7737:Tmx4 UTSW 2 134639668 missense probably benign 0.00
R7857:Tmx4 UTSW 2 134639662 missense probably benign 0.00
R8177:Tmx4 UTSW 2 134643902 missense probably damaging 1.00
R8266:Tmx4 UTSW 2 134639541 missense unknown
R8473:Tmx4 UTSW 2 134609524 missense probably benign 0.00
Z1177:Tmx4 UTSW 2 134598651 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTCAAGCTTAACTTCAC -3'
(R):5'- ACTGCTTGCTTAGAAATGTTCATGG -3'

Sequencing Primer
(F):5'- AGCACTACCTGTGGAGTACTC -3'
(R):5'- TCATGGATGTAGAAGATTTGCCAAG -3'
Posted On2018-02-28