Incidental Mutation 'R6241:Pak4'
ID505238
Institutional Source Beutler Lab
Gene Symbol Pak4
Ensembl Gene ENSMUSG00000030602
Gene Namep21 (RAC1) activated kinase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6241 (G1)
Quality Score215.009
Status Validated
Chromosome7
Chromosomal Location28558819-28598185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28565265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 71 (V71I)
Ref Sequence ENSEMBL: ENSMUSP00000103918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032823] [ENSMUST00000040531] [ENSMUST00000108283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032823
AA Change: V71I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032823
Gene: ENSMUSG00000030602
AA Change: V71I

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108283
AA Change: V71I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103918
Gene: ENSMUSG00000030602
AA Change: V71I

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183983
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die at midgestation exhibiting heart defects as well as impaired neuronal development and yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Pak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0025:Pak4 UTSW 7 28564283 missense probably damaging 1.00
R0531:Pak4 UTSW 7 28568054 missense possibly damaging 0.69
R0893:Pak4 UTSW 7 28559777 missense probably benign 0.21
R1108:Pak4 UTSW 7 28560242 missense probably damaging 1.00
R1801:Pak4 UTSW 7 28565190 missense probably damaging 1.00
R1844:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R3108:Pak4 UTSW 7 28564344 nonsense probably null
R4693:Pak4 UTSW 7 28564249 missense probably damaging 1.00
R5320:Pak4 UTSW 7 28568206 missense probably damaging 0.98
R5357:Pak4 UTSW 7 28564406 missense probably damaging 0.99
R5724:Pak4 UTSW 7 28564580 missense possibly damaging 0.94
R6047:Pak4 UTSW 7 28563036 missense probably benign 0.34
R6161:Pak4 UTSW 7 28565267 missense possibly damaging 0.95
R6820:Pak4 UTSW 7 28563036 missense probably benign 0.34
R7262:Pak4 UTSW 7 28565200 missense possibly damaging 0.60
R7338:Pak4 UTSW 7 28564956 missense probably benign 0.37
R7681:Pak4 UTSW 7 28560230 missense probably damaging 1.00
R8709:Pak4 UTSW 7 28562544 missense probably benign 0.02
Z1088:Pak4 UTSW 7 28565228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTCCAGCTTTGTCAGGG -3'
(R):5'- ATAGGCTGAGTTCTCCTCCC -3'

Sequencing Primer
(F):5'- CAGCTTTGTCAGGGGCCATTC -3'
(R):5'- TAGTCCACAGGGCAGAGCTTG -3'
Posted On2018-02-28