Incidental Mutation 'R6241:Gm5346'
ID505242
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43626096 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 364 (I364L)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably benign
Transcript: ENSMUST00000056023
AA Change: I364L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: I364L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1870:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5032:Gm5346 UTSW 8 43626471 missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6439:Gm5346 UTSW 8 43625951 missense probably damaging 1.00
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43626914 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43625244 missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43626666 missense probably damaging 0.99
R7797:Gm5346 UTSW 8 43626374 missense probably benign 0.04
R8154:Gm5346 UTSW 8 43625387 missense probably damaging 0.97
RF001:Gm5346 UTSW 8 43626905 missense possibly damaging 0.79
Z1177:Gm5346 UTSW 8 43626546 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATTCAGAGTTCCCACAATCAC -3'
(R):5'- AGAAATGTCAGCGGCCCTAG -3'

Sequencing Primer
(F):5'- GAGTTCCCACAATCACACTGCTC -3'
(R):5'- CGGCCCTAGATGCATTCTGTAG -3'
Posted On2018-02-28