Incidental Mutation 'R6241:Itga1'
ID505255
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 114960137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably null
Transcript: ENSMUST00000061673
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Ints9 C T 14: 64,980,210 T62I possibly damaging Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGTACATGGAGCTATGTGACC -3'
(R):5'- TTATGCCACACATGCAGGG -3'

Sequencing Primer
(F):5'- GTGACCACATCTTTGGCTATATTTC -3'
(R):5'- CCACACATGCAGGGTTTTTATTG -3'
Posted On2018-02-28