Incidental Mutation 'R6241:Ints9'
ID505258
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Nameintegrator complex subunit 9
SynonymsD14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6241 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64950045-65039832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64980210 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 62 (T62I)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043914
AA Change: T62I

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: T62I

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225790
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,829 I385V probably benign Het
Ablim2 A G 5: 35,874,897 D622G probably damaging Het
Acsbg1 A T 9: 54,642,662 S86T probably damaging Het
Ank2 A C 3: 127,052,748 D199E probably damaging Het
Art2a-ps T A 7: 101,555,245 M29L probably benign Het
Bbs2 C A 8: 94,098,235 probably null Het
Brwd1 A T 16: 96,013,874 I1402N probably damaging Het
C1qtnf9 C A 14: 60,779,620 P200T possibly damaging Het
Ciita T C 16: 10,511,903 Y684H probably damaging Het
D430042O09Rik C T 7: 125,872,834 H1532Y probably benign Het
Dennd1c T C 17: 57,066,272 N734D probably benign Het
Depdc1b A T 13: 108,324,119 I88F possibly damaging Het
Dsg2 A G 18: 20,590,217 probably null Het
Foxp2 A G 6: 15,394,762 T154A probably damaging Het
Gm14025 T C 2: 129,037,381 D875G possibly damaging Het
Gm5346 T A 8: 43,626,096 I364L probably benign Het
Gmeb1 A T 4: 132,242,377 V95D possibly damaging Het
Gmeb1 A G 4: 132,246,013 S62P probably benign Het
Golga5 T A 12: 102,472,473 V149D probably damaging Het
H1fnt A C 15: 98,256,771 S166A unknown Het
Hivep1 T C 13: 42,158,370 L1362P probably benign Het
Ift81 T C 5: 122,602,351 M205V probably benign Het
Iglv3 T A 16: 19,241,218 Q120L possibly damaging Het
Itga1 G T 13: 114,960,137 probably null Het
Krt77 A C 15: 101,865,553 I222S probably damaging Het
Mrps25 A G 6: 92,183,838 probably null Het
Mrps27 A G 13: 99,412,246 T297A probably benign Het
Mup15 A T 4: 61,439,613 L7Q unknown Het
Naip1 T A 13: 100,425,661 I999F probably damaging Het
Ndst1 A G 18: 60,703,829 F387L probably damaging Het
Nudt9 T C 5: 104,054,285 S71P probably damaging Het
Olfr1042 T G 2: 86,160,036 E111D probably damaging Het
Olfr124 A G 17: 37,805,541 Y132C probably damaging Het
Olfr295 C A 7: 86,586,037 A254D probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pcolce A C 5: 137,605,234 S446A probably benign Het
Per2 T A 1: 91,421,529 N1040I probably damaging Het
Pla2g6 A T 15: 79,304,392 S422T probably benign Het
Pla2r1 G T 2: 60,502,199 probably null Het
Plcb4 T C 2: 135,910,174 V100A possibly damaging Het
Polr1d C T 5: 147,078,723 T72M probably benign Het
Psd3 A C 8: 67,818,139 probably benign Het
Radil T C 5: 142,494,942 E586G probably damaging Het
Rnf150 A G 8: 82,864,464 N152S possibly damaging Het
Serpina1b T A 12: 103,729,256 probably null Het
Setd3 C T 12: 108,157,855 E192K probably benign Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Taok3 T A 5: 117,272,197 M818K probably benign Het
Tmem131l T C 3: 83,922,164 N1062S probably benign Het
Tmx4 C T 2: 134,639,505 probably benign Het
Traip G A 9: 107,968,734 C342Y probably benign Het
Traj9 G T 14: 54,209,433 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vegfc T C 8: 54,181,254 S323P probably benign Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAGCTGAGTCACACACTGTTC -3'
(R):5'- TTTGCAGAGGCCCAGAAGAG -3'

Sequencing Primer
(F):5'- GCTGAGTCACACACTGTTCTTAAAGG -3'
(R):5'- CAACACATCCAAAGGAAATGATTTTC -3'
Posted On2018-02-28