Incidental Mutation 'R6242:Atf6'
ID 505271
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 044434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6242 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 170621545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 492 (Q492L)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect possibly damaging
Transcript: ENSMUST00000027974
AA Change: Q492L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Q492L

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182787
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,501,896 (GRCm39) C239* probably null Het
Akr1c6 A G 13: 4,486,361 (GRCm39) Q56R probably benign Het
Apaf1 T A 10: 90,898,025 (GRCm39) D244V probably damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef11 C A 3: 87,635,385 (GRCm39) A898E probably benign Het
Asxl3 A T 18: 22,655,433 (GRCm39) N1148Y probably damaging Het
Atrnl1 G T 19: 57,630,910 (GRCm39) V226F probably benign Het
Cfap68 C T 9: 50,675,215 (GRCm39) E148K probably benign Het
Cntnap1 A T 11: 101,073,364 (GRCm39) Y615F probably damaging Het
Crybg3 T C 16: 59,376,053 (GRCm39) T1734A probably benign Het
Ctdp1 A C 18: 80,502,427 (GRCm39) V161G probably damaging Het
Cyp4a30b T A 4: 115,311,587 (GRCm39) V85E possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Epha6 A T 16: 59,503,025 (GRCm39) W961R probably damaging Het
Fam114a1 A G 5: 65,188,695 (GRCm39) E475G probably damaging Het
Fam186a A G 15: 99,837,788 (GRCm39) Y2819H unknown Het
Fancm A T 12: 65,163,216 (GRCm39) Q1460L probably benign Het
Fancm C A 12: 65,163,223 (GRCm39) N1462K probably benign Het
Fgf14 T C 14: 124,913,940 (GRCm39) K64E probably benign Het
Fndc5 T C 4: 129,033,688 (GRCm39) V152A probably benign Het
Garem1 C G 18: 21,262,229 (GRCm39) V862L possibly damaging Het
Grin3b G A 10: 79,812,013 (GRCm39) G814R probably damaging Het
Hacd4 A G 4: 88,332,524 (GRCm39) S226P probably benign Het
Htt A G 5: 35,003,356 (GRCm39) Y1277C probably damaging Het
Igkv1-131 T A 6: 67,743,062 (GRCm39) D107V probably damaging Het
Iqcc T C 4: 129,510,639 (GRCm39) D292G probably damaging Het
Krtap13 C T 16: 88,548,384 (GRCm39) V35I probably damaging Het
Liat1 T C 11: 75,890,981 (GRCm39) S32P probably damaging Het
Lrrc59 G T 11: 94,525,809 (GRCm39) L132F possibly damaging Het
Mcub T C 3: 129,709,444 (GRCm39) S290G probably benign Het
Mettl4 A G 17: 95,042,802 (GRCm39) W345R probably damaging Het
Msgn1 G A 12: 11,258,526 (GRCm39) R142W probably damaging Het
Myo5c A G 9: 75,180,893 (GRCm39) I761V probably benign Het
Neb T A 2: 52,066,824 (GRCm39) K5879M probably damaging Het
Nkd2 C T 13: 73,970,905 (GRCm39) V226M probably damaging Het
Nt5el T A 13: 105,246,048 (GRCm39) V203E probably benign Het
Or51a24 T G 7: 103,733,771 (GRCm39) H172P possibly damaging Het
Or5b106 T A 19: 13,123,450 (GRCm39) H191L probably benign Het
Parp4 T A 14: 56,832,856 (GRCm39) L393* probably null Het
Pcdhgb6 G A 18: 37,876,608 (GRCm39) V439I probably benign Het
Pde1a T A 2: 79,959,136 (GRCm39) T15S probably benign Het
Pgr T A 9: 8,900,980 (GRCm39) I171N probably benign Het
Podxl T A 6: 31,503,180 (GRCm39) D296V probably benign Het
Polr3e A T 7: 120,539,690 (GRCm39) E479V possibly damaging Het
Prdm10 A T 9: 31,252,548 (GRCm39) H427L possibly damaging Het
Prl5a1 A T 13: 28,326,538 (GRCm39) K5* probably null Het
Prph A G 15: 98,955,004 (GRCm39) S325G probably damaging Het
Rabl2 C A 15: 89,468,555 (GRCm39) W49L probably benign Het
Rbbp8nl T A 2: 179,922,767 (GRCm39) I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Scn7a T C 2: 66,531,110 (GRCm39) D589G probably benign Het
Sdr42e1 A T 8: 118,389,936 (GRCm39) L235Q possibly damaging Het
Serpina3a T C 12: 104,082,260 (GRCm39) M11T probably benign Het
Slc6a4 A T 11: 76,909,184 (GRCm39) K399* probably null Het
Slco4c1 T A 1: 96,767,008 (GRCm39) T337S probably damaging Het
Spc25 A T 2: 69,027,555 (GRCm39) F112L probably damaging Het
Swt1 A G 1: 151,283,365 (GRCm39) S331P probably benign Het
Tab1 A T 15: 80,039,971 (GRCm39) K264* probably null Het
Tagln3 T A 16: 45,544,701 (GRCm39) probably benign Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tbck A G 3: 132,400,189 (GRCm39) D80G probably benign Het
Tcim A T 8: 24,928,911 (GRCm39) M1K probably null Het
Thap2 A G 10: 115,208,831 (GRCm39) S37P unknown Het
Tjp2 A T 19: 24,076,967 (GRCm39) probably null Het
Tln1 G A 4: 43,533,145 (GRCm39) S2390L probably damaging Het
Trpm5 T G 7: 142,626,919 (GRCm39) I1101L probably benign Het
Ttc3 T G 16: 94,243,554 (GRCm39) M831R probably benign Het
Tulp3 A G 6: 128,300,050 (GRCm39) C459R probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Unc13b A T 4: 43,165,800 (GRCm39) T195S possibly damaging Het
Urgcp A G 11: 5,666,691 (GRCm39) L549P probably benign Het
Usp10 G T 8: 120,668,577 (GRCm39) A293S probably benign Het
Vmn2r23 A G 6: 123,681,359 (GRCm39) E89G possibly damaging Het
Vmn2r75 A C 7: 85,814,592 (GRCm39) D300E probably damaging Het
Wif1 T C 10: 120,870,366 (GRCm39) I40T possibly damaging Het
Zmynd8 G A 2: 165,740,867 (GRCm39) R6C possibly damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R0784:Atf6 UTSW 1 170,537,516 (GRCm39) missense probably benign 0.19
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1850:Atf6 UTSW 1 170,646,855 (GRCm39) missense probably damaging 1.00
R1945:Atf6 UTSW 1 170,682,710 (GRCm39) missense probably benign 0.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4631:Atf6 UTSW 1 170,574,766 (GRCm39) splice site probably null
R4676:Atf6 UTSW 1 170,614,979 (GRCm39) missense probably damaging 1.00
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGATACAGTACCCTGCCTGC -3'
(R):5'- GCTGTTCTTTGGGTCCTATAGAAC -3'

Sequencing Primer
(F):5'- GATACAGTACCCTGCCTGCTAGAG -3'
(R):5'- ATGAACTTCGAGGCTGG -3'
Posted On 2018-02-28