Incidental Mutation 'R6242:Scn7a'
ID505273
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6242 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66700766 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 589 (D589G)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably benign
Transcript: ENSMUST00000042792
AA Change: D589G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: D589G

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Akr1c6 A G 13: 4,436,362 Q56R probably benign Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fancm A T 12: 65,116,442 Q1460L probably benign Het
Fancm C A 12: 65,116,449 N1462K probably benign Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Prph A G 15: 99,057,123 S325G probably damaging Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Unc13b A T 4: 43,165,800 T195S possibly damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7916:Scn7a UTSW 2 66676150 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCCTACATTTATGCACATTGAAAAC -3'
(R):5'- CAGGCCTGTGTGTTGAATGT -3'

Sequencing Primer
(F):5'- CCTTTTATGTTCAAGAAAGTGAG -3'
(R):5'- GTTAACTGCGGAAATGTTCTTACC -3'
Posted On2018-02-28