Incidental Mutation 'R6242:Unc13b'
ID505281
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R6242 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43165800 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 195 (T195S)
Ref Sequence ENSEMBL: ENSMUSP00000078894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079978
AA Change: T195S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: T195S

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: T207S

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: T207S

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107953
AA Change: T195S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: T195S

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151611
Predicted Effect probably benign
Transcript: ENSMUST00000163653
AA Change: T207S

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: T207S

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171234
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: T195S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Akr1c6 A G 13: 4,436,362 Q56R probably benign Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fancm A T 12: 65,116,442 Q1460L probably benign Het
Fancm C A 12: 65,116,449 N1462K probably benign Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Prph A G 15: 99,057,123 S325G probably damaging Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn7a T C 2: 66,700,766 D589G probably benign Het
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7941:Unc13b UTSW 4 43176285 missense unknown
R7950:Unc13b UTSW 4 43232573 nonsense probably null
R7980:Unc13b UTSW 4 43171860 missense unknown
R7987:Unc13b UTSW 4 43217075 missense probably benign
R8069:Unc13b UTSW 4 43177597 missense unknown
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATGTCCCTGACTTCCGTG -3'
(R):5'- ATCATGGGACCTGGATCAATACC -3'

Sequencing Primer
(F):5'- TGACTTCCGTGCGGCTC -3'
(R):5'- CTGGATCAATACCAACCTGAGGG -3'
Posted On2018-02-28