Mutagenetix > Incidental Mutation

Incidental Mutation 'R6242:Rsf1'

505295

Institutional Source

Beutler Lab

Gene Symbol

Rsf1

Ensembl Gene

ENSMUSG00000035623

Gene Name

remodeling and spacing factor 1

Synonyms

p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6242 (G1)

Quality Score

214.458

Status

Not validated

Chromosome

Chromosomal Location

97579889-97692778 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

ATGGCG to ATGGCGACGGTGGCG at 97579904 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000178078] [ENSMUST00000154853] [ENSMUST00000146605]

AlphaFold

E9PWW9

Predicted Effect

unknown
Transcript: ENSMUST00000042399

SMART Domains

Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

Domain	Start	End	E-Value	Type
low complexity region	1	17	N/A	INTRINSIC
low complexity region	40	53	N/A	INTRINSIC
Pfam:WHIM1	103	153	9.3e-11	PFAM
Pfam:WHIM2	155	187	7.2e-10	PFAM
low complexity region	236	246	N/A	INTRINSIC
low complexity region	299	311	N/A	INTRINSIC
low complexity region	758	773	N/A	INTRINSIC
low complexity region	860	874	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
PHD	896	942	1.57e-11	SMART
low complexity region	960	974	N/A	INTRINSIC
low complexity region	986	1008	N/A	INTRINSIC
low complexity region	1026	1045	N/A	INTRINSIC
low complexity region	1087	1111	N/A	INTRINSIC
low complexity region	1125	1143	N/A	INTRINSIC
low complexity region	1148	1167	N/A	INTRINSIC
low complexity region	1175	1205	N/A	INTRINSIC
low complexity region	1207	1213	N/A	INTRINSIC
low complexity region	1249	1263	N/A	INTRINSIC
low complexity region	1283	1295	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042627

SMART Domains

Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:DUF498	68	115	1.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072725

SMART Domains

Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:DUF498	68	115	1.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107153

SMART Domains

Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
Pfam:WHIM1	88	138	2.2e-10	PFAM
Pfam:WHIM2	140	172	9.4e-8	PFAM
Pfam:WHIM3	178	398	2.5e-27	PFAM
low complexity region	743	758	N/A	INTRINSIC
low complexity region	845	859	N/A	INTRINSIC
low complexity region	863	872	N/A	INTRINSIC
PHD	881	927	1.57e-11	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	971	993	N/A	INTRINSIC
low complexity region	1011	1030	N/A	INTRINSIC
low complexity region	1072	1096	N/A	INTRINSIC
low complexity region	1110	1128	N/A	INTRINSIC
low complexity region	1133	1152	N/A	INTRINSIC
low complexity region	1160	1190	N/A	INTRINSIC
low complexity region	1192	1198	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1268	1280	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124552

SMART Domains

Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
Pfam:DUF498	2	49	8.5e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126085

SMART Domains

Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
SCOP:d1uroa_	21	60	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127891

Predicted Effect

probably benign
Transcript: ENSMUST00000135998

SMART Domains

Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:DUF498	34	128	4.8e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136757

SMART Domains

Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
Pfam:DUF498	6	119	2.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138060

SMART Domains

Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
Pfam:DUF498	40	87	1.7e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140805

Predicted Effect

probably benign
Transcript: ENSMUST00000144858

SMART Domains

Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
Pfam:DUF498	11	65	3.8e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156060

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205536

Predicted Effect

probably benign
Transcript: ENSMUST00000151840

SMART Domains

Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:2Q4Q\|B	31	75	5e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000154779

SMART Domains

Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
transmembrane domain	30	49	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178078

SMART Domains

Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:DUF498	34	147	2.7e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154853

SMART Domains

Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:DUF498	34	147	9.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146605

SMART Domains

Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

Domain	Start	End	E-Value	Type
Pfam:DUF498	23	136	3.4e-28	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	C	T	9: 50,763,915	E148K	probably benign	Het
1700016K19Rik	T	C	11: 76,000,155	S32P	probably damaging	Het
4933425L06Rik	T	A	13: 105,109,540	V203E	probably benign	Het
Adcy6	G	T	15: 98,604,015	C239*	probably null	Het
Akr1c6	A	G	13: 4,436,362	Q56R	probably benign	Het
Apaf1	T	A	10: 91,062,163	D244V	probably damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Arhgef11	C	A	3: 87,728,078	A898E	probably benign	Het
Asxl3	A	T	18: 22,522,376	N1148Y	probably damaging	Het
Atf6	T	A	1: 170,793,976	Q492L	possibly damaging	Het
Atrnl1	G	T	19: 57,642,478	V226F	probably benign	Het
Cntnap1	A	T	11: 101,182,538	Y615F	probably damaging	Het
Crybg3	T	C	16: 59,555,690	T1734A	probably benign	Het
Ctdp1	A	C	18: 80,459,212	V161G	probably damaging	Het
Cyp4a30b	T	A	4: 115,454,390	V85E	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Epha6	A	T	16: 59,682,662	W961R	probably damaging	Het
Fam114a1	A	G	5: 65,031,352	E475G	probably damaging	Het
Fam186a	A	G	15: 99,939,907	Y2819H	unknown	Het
Fancm	A	T	12: 65,116,442	Q1460L	probably benign	Het
Fancm	C	A	12: 65,116,449	N1462K	probably benign	Het
Fgf14	T	C	14: 124,676,528	K64E	probably benign	Het
Fndc5	T	C	4: 129,139,895	V152A	probably benign	Het
Garem1	C	G	18: 21,129,172	V862L	possibly damaging	Het
Grin3b	G	A	10: 79,976,179	G814R	probably damaging	Het
Hacd4	A	G	4: 88,414,287	S226P	probably benign	Het
Htt	A	G	5: 34,846,012	Y1277C	probably damaging	Het
Igkv1-131	T	A	6: 67,766,078	D107V	probably damaging	Het
Iqcc	T	C	4: 129,616,846	D292G	probably damaging	Het
Krtap13	C	T	16: 88,751,496	V35I	probably damaging	Het
Lrrc59	G	T	11: 94,634,983	L132F	possibly damaging	Het
Mcub	T	C	3: 129,915,795	S290G	probably benign	Het
Mettl4	A	G	17: 94,735,374	W345R	probably damaging	Het
Msgn1	G	A	12: 11,208,525	R142W	probably damaging	Het
Myo5c	A	G	9: 75,273,611	I761V	probably benign	Het
Neb	T	A	2: 52,176,812	K5879M	probably damaging	Het
Nkd2	C	T	13: 73,822,786	V226M	probably damaging	Het
Olfr1459	T	A	19: 13,146,086	H191L	probably benign	Het
Olfr645	T	G	7: 104,084,564	H172P	possibly damaging	Het
Parp4	T	A	14: 56,595,399	L393*	probably null	Het
Pcdhgb6	G	A	18: 37,743,555	V439I	probably benign	Het
Pde1a	T	A	2: 80,128,792	T15S	probably benign	Het
Pgr	T	A	9: 8,900,979	I171N	probably benign	Het
Podxl	T	A	6: 31,526,245	D296V	probably benign	Het
Polr3e	A	T	7: 120,940,467	E479V	possibly damaging	Het
Prdm10	A	T	9: 31,341,252	H427L	possibly damaging	Het
Prl5a1	A	T	13: 28,142,555	K5*	probably null	Het
Prph	A	G	15: 99,057,123	S325G	probably damaging	Het
Rabl2	C	A	15: 89,584,352	W49L	probably benign	Het
Rbbp8nl	T	A	2: 180,280,974	I209F	probably damaging	Het
Scn7a	T	C	2: 66,700,766	D589G	probably benign	Het
Sdr42e1	A	T	8: 117,663,197	L235Q	possibly damaging	Het
Serpina3a	T	C	12: 104,116,001	M11T	probably benign	Het
Slc6a4	A	T	11: 77,018,358	K399*	probably null	Het
Slco4c1	T	A	1: 96,839,283	T337S	probably damaging	Het
Spc25	A	T	2: 69,197,211	F112L	probably damaging	Het
Swt1	A	G	1: 151,407,614	S331P	probably benign	Het
Tab1	A	T	15: 80,155,770	K264*	probably null	Het
Tagln3	T	A	16: 45,724,338		probably benign	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tbck	A	G	3: 132,694,428	D80G	probably benign	Het
Tcim	A	T	8: 24,438,895	M1K	probably null	Het
Thap2	A	G	10: 115,372,926	S37P	unknown	Het
Tjp2	A	T	19: 24,099,603		probably null	Het
Tln1	G	A	4: 43,533,145	S2390L	probably damaging	Het
Trpm5	T	G	7: 143,073,182	I1101L	probably benign	Het
Ttc3	T	G	16: 94,442,695	M831R	probably benign	Het
Tulp3	A	G	6: 128,323,087	C459R	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Unc13b	A	T	4: 43,165,800	T195S	possibly damaging	Het
Urgcp	A	G	11: 5,716,691	L549P	probably benign	Het
Usp10	G	T	8: 119,941,838	A293S	probably benign	Het
Vmn2r23	A	G	6: 123,704,400	E89G	possibly damaging	Het
Vmn2r75	A	C	7: 86,165,384	D300E	probably damaging	Het
Wif1	T	C	10: 121,034,461	I40T	possibly damaging	Het
Zmynd8	G	A	2: 165,898,947	R6C	possibly damaging	Het

Other mutations in Rsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Rsf1	APN	7	97681889	critical splice donor site	probably null	0.00
IGL01160:Rsf1	APN	7	97685584	missense	probably damaging	1.00
IGL01780:Rsf1	APN	7	97664770	critical splice donor site	probably benign	0.00
IGL01960:Rsf1	APN	7	97661575	missense	probably benign	0.00
IGL02487:Rsf1	APN	7	97639491	missense	probably damaging	0.99
IGL02814:Rsf1	APN	7	97661227	missense	probably damaging	1.00
IGL02972:Rsf1	APN	7	97661326	missense	probably benign	0.35
IGL03176:Rsf1	APN	7	97679150	splice site	probably benign
IGL03256:Rsf1	APN	7	97679004	missense	possibly damaging	0.82
BB011:Rsf1	UTSW	7	97579909	unclassified	probably benign
BB014:Rsf1	UTSW	7	97579924	unclassified	probably benign
BB018:Rsf1	UTSW	7	97579909	unclassified	probably benign
FR4976:Rsf1	UTSW	7	97579909	unclassified	probably benign
G1Funyon:Rsf1	UTSW	7	97661925	missense
P0023:Rsf1	UTSW	7	97662271	missense	probably damaging	1.00
R0144:Rsf1	UTSW	7	97636407	missense	probably damaging	1.00
R0380:Rsf1	UTSW	7	97579905	unclassified	probably benign
R0392:Rsf1	UTSW	7	97679005	missense	probably benign	0.00
R0422:Rsf1	UTSW	7	97680817	missense	probably benign	0.04
R0584:Rsf1	UTSW	7	97662128	missense	possibly damaging	0.60
R0636:Rsf1	UTSW	7	97662019	missense	possibly damaging	0.74
R0729:Rsf1	UTSW	7	97679027	missense	probably damaging	1.00
R0755:Rsf1	UTSW	7	97579967	missense	probably damaging	1.00
R0947:Rsf1	UTSW	7	97669778	missense	probably damaging	1.00
R1278:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1498:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1525:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1534:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1582:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1591:Rsf1	UTSW	7	97639313	nonsense	probably null
R1676:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1695:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1710:Rsf1	UTSW	7	97662349	missense	possibly damaging	0.50
R1722:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1764:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1823:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1864:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1884:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1897:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1915:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1928:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1958:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1996:Rsf1	UTSW	7	97664632	missense	probably damaging	1.00
R1999:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2021:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2022:Rsf1	UTSW	7	97579910	unclassified	probably benign
R2046:Rsf1	UTSW	7	97661677	missense	probably benign	0.00
R2048:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2093:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2103:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2137:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2167:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2179:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2191:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2207:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2211:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2241:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2264:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2283:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2297:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2307:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2419:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2442:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2696:Rsf1	UTSW	7	97579933	unclassified	probably benign
R2764:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2939:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2965:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2972:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3008:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3013:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3026:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3110:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3147:Rsf1	UTSW	7	97579908	unclassified	probably benign
R3427:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3610:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R3624:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3753:Rsf1	UTSW	7	97662152	missense	probably benign	0.00
R3759:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3780:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3794:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3889:Rsf1	UTSW	7	97579906	unclassified	probably benign
R3925:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3964:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4037:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4084:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4240:Rsf1	UTSW	7	97579935	unclassified	probably benign
R4303:Rsf1	UTSW	7	97579920	unclassified	probably benign
R4383:Rsf1	UTSW	7	97685476	missense	possibly damaging	0.86
R4492:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4525:Rsf1	UTSW	7	97579926	unclassified	probably benign
R4530:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4543:Rsf1	UTSW	7	97579922	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579908	unclassified	probably benign
R4632:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4633:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4652:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579910	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R4677:Rsf1	UTSW	7	97680773	missense	possibly damaging	0.82
R4678:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4769:Rsf1	UTSW	7	97676222	missense	probably damaging	1.00
R4774:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4820:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4917:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4918:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4977:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4979:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579909	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579923	unclassified	probably benign
R5041:Rsf1	UTSW	7	97579925	unclassified	probably benign
R5125:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5178:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5306:Rsf1	UTSW	7	97579929	unclassified	probably benign
R5369:Rsf1	UTSW	7	97579904	unclassified	probably benign
R5371:Rsf1	UTSW	7	97579913	unclassified	probably benign
R5403:Rsf1	UTSW	7	97579907	unclassified	probably benign
R5436:Rsf1	UTSW	7	97579931	unclassified	probably benign
R5450:Rsf1	UTSW	7	97579908	unclassified	probably benign
R5532:Rsf1	UTSW	7	97680695	missense	probably damaging	1.00
R5587:Rsf1	UTSW	7	97662121	missense	probably benign	0.02
R5657:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5689:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5745:Rsf1	UTSW	7	97579920	unclassified	probably benign
R5748:Rsf1	UTSW	7	97579928	unclassified	probably benign
R5773:Rsf1	UTSW	7	97579933	unclassified	probably benign
R5859:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R5938:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R6001:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6001:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6001:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6021:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6025:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6036:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6073:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6077:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6102:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6111:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6126:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6128:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6130:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6154:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6154:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6165:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6166:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6182:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6189:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6200:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6210:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6212:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6214:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6215:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6216:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6232:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6235:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6243:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6244:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6268:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6269:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6273:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6275:Rsf1	UTSW	7	97579923	unclassified	probably benign
R6286:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6291:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6293:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6297:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6302:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6309:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6312:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6324:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6343:Rsf1	UTSW	7	97660917	missense	probably benign	0.30
R6346:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6356:Rsf1	UTSW	7	97661934	missense	probably benign
R6370:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6378:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6394:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6398:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6406:Rsf1	UTSW	7	97579926	unclassified	probably benign
R6413:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6443:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6453:Rsf1	UTSW	7	97579917	unclassified	probably benign
R6471:Rsf1	UTSW	7	97579914	unclassified	probably benign
R6473:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6497:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6505:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6561:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6572:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6607:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6611:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6622:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6626:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6636:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6647:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6648:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6669:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6673:Rsf1	UTSW	7	97579918	unclassified	probably benign
R6679:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6685:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6695:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6697:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6726:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6739:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6747:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6751:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6771:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6773:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6787:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6800:Rsf1	UTSW	7	97579932	unclassified	probably benign
R6804:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6806:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6815:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6820:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6823:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6829:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6861:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6862:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6869:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6875:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6889:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6897:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6960:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6963:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6967:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6969:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6977:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6996:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7066:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7109:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7127:Rsf1	UTSW	7	97579914	unclassified	probably benign
R7138:Rsf1	UTSW	7	97669795	missense
R7214:Rsf1	UTSW	7	97579929	unclassified	probably benign
R7217:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7238:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7246:Rsf1	UTSW	7	97579922	unclassified	probably benign
R7253:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7294:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7305:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7309:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7352:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7380:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7393:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7395:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7411:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7413:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7481:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7538:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7541:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7545:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7574:Rsf1	UTSW	7	97661167	missense
R7578:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7599:Rsf1	UTSW	7	97579904	unclassified	probably benign
R7630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7632:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7710:Rsf1	UTSW	7	97681834	missense
R7711:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7715:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7719:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7722:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7729:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7734:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7743:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7761:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7764:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7797:Rsf1	UTSW	7	97661485	missense
R7802:Rsf1	UTSW	7	97661772	missense
R7806:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7821:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7823:Rsf1	UTSW	7	97579907	unclassified	probably benign
R7824:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7825:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7826:Rsf1	UTSW	7	97661161	unclassified	probably benign
R7841:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R7854:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7862:Rsf1	UTSW	7	97579923	unclassified	probably benign
R7893:Rsf1	UTSW	7	97661958	missense
R7923:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7924:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7927:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7931:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7951:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7957:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7960:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7979:Rsf1	UTSW	7	97685713	missense
R7982:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7991:Rsf1	UTSW	7	97661333	missense
R8028:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8030:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8042:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8062:Rsf1	UTSW	7	97677387	missense
R8076:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8117:Rsf1	UTSW	7	97639257	splice site	probably null
R8132:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8153:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8155:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8166:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8197:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8235:Rsf1	UTSW	7	97676254	utr 3 prime	probably benign
R8245:Rsf1	UTSW	7	97579915	unclassified	probably benign
R8282:Rsf1	UTSW	7	97579920	frame shift	probably null
R8301:Rsf1	UTSW	7	97661925	missense
R8315:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8343:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8370:Rsf1	UTSW	7	97579929	unclassified	probably benign
R8372:Rsf1	UTSW	7	97662417	missense
R8376:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8382:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8392:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8410:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8443:Rsf1	UTSW	7	97616896	missense
R8502:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8529:Rsf1	UTSW	7	97670867	utr 3 prime	probably benign
R8537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8554:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8558:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8735:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8742:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8772:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8862:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8866:Rsf1	UTSW	7	97579913	unclassified	probably benign
R8889:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8889:Rsf1	UTSW	7	97678964	missense
R8891:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8892:Rsf1	UTSW	7	97678964	missense
R8907:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8907:Rsf1	UTSW	7	97579918	unclassified	probably benign
R8913:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8916:Rsf1	UTSW	7	97579933	unclassified	probably benign
R8924:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8940:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8946:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8947:Rsf1	UTSW	7	97681852	unclassified	probably benign
R8951:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8975:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9033:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9044:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9060:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9066:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9079:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9080:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9094:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9096:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9101:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9102:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9123:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9125:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9126:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9128:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9157:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9159:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9161:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9187:Rsf1	UTSW	7	97579933	unclassified	probably benign
R9240:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9250:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9257:Rsf1	UTSW	7	97685711	missense
R9288:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9345:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9406:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9411:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9414:Rsf1	UTSW	7	97664558	critical splice acceptor site	probably null
R9420:Rsf1	UTSW	7	97579927	unclassified	probably benign
R9421:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9423:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9427:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9448:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9452:Rsf1	UTSW	7	97579926	unclassified	probably benign
R9454:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9467:Rsf1	UTSW	7	97579913	unclassified	probably benign
R9468:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9483:Rsf1	UTSW	7	97579930	unclassified	probably benign
R9488:Rsf1	UTSW	7	97579922	unclassified	probably benign
R9502:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9507:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9509:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9519:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9526:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9581:Rsf1	UTSW	7	97579918	unclassified	probably benign
R9590:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9592:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9618:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9685:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9716:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9748:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9774:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9795:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9802:Rsf1	UTSW	7	97579906	unclassified	probably benign
RF034:Rsf1	UTSW	7	97579908	unclassified	probably benign
RF036:Rsf1	UTSW	7	97579908	unclassified	probably benign
X0025:Rsf1	UTSW	7	97636444	missense	probably damaging	1.00
X0028:Rsf1	UTSW	7	97660824	nonsense	probably null
Y4335:Rsf1	UTSW	7	97579904	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CCGATCTAACTCAGTTCTCGAC -3'
(R):5'- AGAGCCCCAGGGTATCTATG -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- CCCAGGGTATCTATGGAGAGC -3'

Posted On

2018-02-28