Incidental Mutation 'R6242:Prph'
ID505329
Institutional Source Beutler Lab
Gene Symbol Prph
Ensembl Gene ENSMUSG00000023484
Gene Nameperipherin
SynonymsPrph1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6242 (G1)
Quality Score121.008
Status Validated
Chromosome15
Chromosomal Location99055174-99058978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99057123 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 325 (S325G)
Ref Sequence ENSEMBL: ENSMUSP00000024249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]
Predicted Effect probably damaging
Transcript: ENSMUST00000024249
AA Change: S325G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: S325G

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 2.7e-18 PFAM
Pfam:Filament 100 410 4.5e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047104
AA Change: S357G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: S357G

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 3.2e-18 PFAM
Filament 100 442 1.87e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229268
Predicted Effect probably benign
Transcript: ENSMUST00000230021
AA Change: S357G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1203 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Akr1c6 A G 13: 4,436,362 Q56R probably benign Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fancm A T 12: 65,116,442 Q1460L probably benign Het
Fancm C A 12: 65,116,449 N1462K probably benign Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn7a T C 2: 66,700,766 D589G probably benign Het
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Unc13b A T 4: 43,165,800 T195S possibly damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Prph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Prph APN 15 99058636 missense possibly damaging 0.88
IGL01472:Prph APN 15 99058593 splice site probably benign
IGL01868:Prph APN 15 99056343 missense probably damaging 1.00
IGL02714:Prph APN 15 99056866 missense probably damaging 1.00
IGL02816:Prph APN 15 99057420 missense probably damaging 0.97
R0242:Prph UTSW 15 99055727 missense probably damaging 1.00
R0396:Prph UTSW 15 99056991 missense probably benign
R0441:Prph UTSW 15 99057438 missense probably damaging 1.00
R2065:Prph UTSW 15 99056133 missense probably damaging 1.00
R2326:Prph UTSW 15 99055282 unclassified probably benign
R3115:Prph UTSW 15 99055456 missense probably damaging 1.00
R4441:Prph UTSW 15 99057124 missense probably damaging 1.00
R4794:Prph UTSW 15 99057427 missense probably damaging 1.00
R5058:Prph UTSW 15 99055232 unclassified probably benign
R5463:Prph UTSW 15 99055400 missense probably benign 0.43
R6199:Prph UTSW 15 99056832 missense probably benign 0.33
R6502:Prph UTSW 15 99056386 missense probably damaging 1.00
R7356:Prph UTSW 15 99056926 missense probably damaging 1.00
R7818:Prph UTSW 15 99057872 missense probably damaging 1.00
R8353:Prph UTSW 15 99056776 missense probably benign 0.02
Z1177:Prph UTSW 15 99056380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCGCGGCAAAGAATCTG -3'
(R):5'- TGTCGAAGCTCTTCCTCCAG -3'

Sequencing Primer
(F):5'- GTGGTATAAGTCGAAAGTGCG -3'
(R):5'- GGCGAACTGCTCTTCCAG -3'
Posted On2018-02-28