Incidental Mutation 'R6242:Fam186a'
ID505330
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6242 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99939907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2819 (Y2819H)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: Y2819H
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: Y2819H

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Akr1c6 A G 13: 4,436,362 Q56R probably benign Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fancm A T 12: 65,116,442 Q1460L probably benign Het
Fancm C A 12: 65,116,449 N1462K probably benign Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Prph A G 15: 99,057,123 S325G probably damaging Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn7a T C 2: 66,700,766 D589G probably benign Het
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Unc13b A T 4: 43,165,800 T195S possibly damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGCGTCTGATACAGCGAAG -3'
(R):5'- ACTTCTGAAAAGGGCCAGAAAC -3'

Sequencing Primer
(F):5'- CGTCTGATACAGCGAAGGAAGG -3'
(R):5'- AGGGCCAGAAACCATGGCTC -3'
Posted On2018-02-28