Incidental Mutation 'R6243:Tnfrsf8'
ID505363
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145303101 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 43 (N43S)
Ref Sequence ENSEMBL: ENSMUSP00000030339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030339
AA Change: N43S

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: N43S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123027
AA Change: N43S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: N43S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5632:Tnfrsf8 UTSW 4 145292633 missense possibly damaging 0.68
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R5877:Tnfrsf8 UTSW 4 145292687 missense probably benign 0.20
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R7505:Tnfrsf8 UTSW 4 145269115 missense probably damaging 1.00
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGTCTTCCCAGAAGGCAGC -3'
(R):5'- ATCTCTAGGACGGTAGGTCTCAG -3'

Sequencing Primer
(F):5'- ACCCTGTGACATTAGAGATGGCC -3'
(R):5'- AGGTCTCAGCCTTGACAGTGAG -3'
Posted On2018-02-28