Mutagenetix > Incidental Mutations

Incidental Mutation 'R6243:Thsd7a'

505375

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

044365-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6243 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12327602 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1424 (D1424N)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: D1424N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: D1424N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135450

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: D1424N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: D1424N

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Meta Mutation Damage Score

0.0645

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts6	T	C	13: 104,314,301	S331P	probably damaging	Het
Akap9	T	G	5: 4,065,000		probably null	Het
Ankef1	A	G	2: 136,537,157	E9G	probably damaging	Het
Ap1g2	T	C	14: 55,099,073	E788G	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Asrgl1	A	T	19: 9,116,504	I220K	probably damaging	Het
Atg16l2	A	C	7: 101,292,329	*404E	probably null	Het
Atp4a	T	C	7: 30,715,957	F334S	possibly damaging	Het
Atp6v0d1	T	C	8: 105,565,863	E17G	probably benign	Het
Bcat2	T	C	7: 45,588,267	V279A	probably benign	Het
Birc6	T	G	17: 74,609,387	M459R	probably damaging	Het
Bsn	T	C	9: 108,107,561	Y3098C	unknown	Het
Btaf1	T	A	19: 36,981,120	M679K	probably benign	Het
Col6a4	T	C	9: 106,013,390	T1902A	possibly damaging	Het
Crhr1	G	A	11: 104,173,914	C364Y	probably damaging	Het
Crmp1	T	C	5: 37,288,944	L648P	probably damaging	Het
Cyfip1	T	C	7: 55,900,529	Y671H	probably damaging	Het
Cyp2b13	C	T	7: 26,061,619	P34S	probably damaging	Het
Dnajb6	T	A	5: 29,781,133	V233E	probably benign	Het
Dnhd1	A	T	7: 105,652,009	H191L	probably damaging	Het
Dsg3	T	A	18: 20,539,724	D817E	probably damaging	Het
Dytn	T	C	1: 63,647,521	Q330R	possibly damaging	Het
Fads1	G	T	19: 10,185,727	E123*	probably null	Het
Fchsd2	T	C	7: 101,271,809		probably benign	Het
Fmo9	T	C	1: 166,667,369	E270G	probably benign	Het
Folr1	T	A	7: 101,863,965	H41L	probably damaging	Het
Gm29776	T	A	14: 54,695,759	R322S	probably damaging	Het
Gm7298	A	G	6: 121,779,137	N985S	possibly damaging	Het
Gp1ba	T	C	11: 70,640,137		probably benign	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Igf2bp3	A	T	6: 49,107,428	N285K	possibly damaging	Het
Lca5l	G	A	16: 96,178,912	T6I	possibly damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Mpeg1	A	G	19: 12,462,240	H354R	probably benign	Het
Msh6	T	A	17: 87,983,571	V195E	possibly damaging	Het
Mtfmt	C	T	9: 65,443,900	T243I	probably benign	Het
Myo1h	T	A	5: 114,362,147	I195K	probably damaging	Het
Nr1h5	T	C	3: 102,949,064	K300E	probably benign	Het
Nuak2	T	C	1: 132,332,367	S628P	probably benign	Het
Nup214	G	T	2: 32,002,932	A721S	possibly damaging	Het
Olfr1148	A	G	2: 87,833,041	M1V	probably null	Het
Olfr74	A	G	2: 87,974,587	V26A	probably benign	Het
Pclo	T	C	5: 14,676,443		probably benign	Het
Phf20	A	G	2: 156,223,400	S12G	probably benign	Het
Pik3r5	T	C	11: 68,492,000	Y289H	probably damaging	Het
Pld1	T	C	3: 28,095,805	I717T	probably damaging	Het
Plxdc1	A	G	11: 97,955,473	Y182H	probably damaging	Het
Ppid	A	G	3: 79,603,066	I354V	probably benign	Het
Prss2	T	C	6: 41,524,453	V152A	probably benign	Het
Rab28	C	T	5: 41,635,880	A141T	probably benign	Het
Rabgap1l	C	T	1: 160,645,307		probably null	Het
Rabl6	T	G	2: 25,585,403	S553R	probably damaging	Het
Rars	A	G	11: 35,826,547	F170S	possibly damaging	Het
Ror2	T	A	13: 53,113,080	M440L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsph4a	A	T	10: 33,909,143	Q350L	probably damaging	Het
Serpinb2	T	C	1: 107,523,139	F204L	probably damaging	Het
Sertad4	T	C	1: 192,850,949		probably null	Het
Shisa3	C	T	5: 67,611,143	P129S	probably benign	Het
Slc13a2	G	A	11: 78,404,708	L111F	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Stab2	T	A	10: 86,907,161	R1195W	probably damaging	Het
Syna	C	A	5: 134,560,114		probably benign	Het
Thada	A	T	17: 84,436,602	D759E	probably benign	Het
Thoc5	A	G	11: 4,919,753	Y385C	possibly damaging	Het
Thsd7b	A	T	1: 130,162,862	Q1204L	probably benign	Het
Tnfrsf8	T	C	4: 145,303,101	N43S	possibly damaging	Het
Trim66	T	C	7: 109,460,274	K921R	probably benign	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ugt2a2	T	G	5: 87,462,959	K339N	probably benign	Het
Vmn2r8	T	C	5: 108,799,345	T514A	probably benign	Het
Wrn	A	T	8: 33,284,654	M652K	possibly damaging	Het
Yme1l1	A	T	2: 23,193,172	Y550F	probably benign	Het
Zfp995	G	A	17: 21,880,288	P322S	probably damaging	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense

Predicted Primers

PCR Primer
(F):5'- GGGAAAGCACCCTCTTAGAG -3'
(R):5'- GATCATGACAGACAAACTTCAGATC -3'

Sequencing Primer
(F):5'- ATAGGGTGGAGGGCTCATG -3'
(R):5'- TGACAGACAAACTTCAGATCATAGC -3'

Posted On

2018-02-28