Incidental Mutation 'R6243:Thsd7a'
ID505375
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12327602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1424 (D1424N)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: D1424N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: D1424N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122369
SMART Domains Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 43 100 6.24e-6 SMART
TSP1 178 228 7.31e-2 SMART
Blast:TSP1 232 302 4e-26 BLAST
TSP1 307 362 9.09e-8 SMART
TSP1 365 430 5.82e-1 SMART
TSP1 435 487 4.24e-2 SMART
TSP1 490 551 1e0 SMART
TSP1 556 608 3.55e-10 SMART
TSP1 609 679 7.5e-2 SMART
TSP1 684 742 1.55e-1 SMART
transmembrane domain 874 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135450
Predicted Effect probably damaging
Transcript: ENSMUST00000172356
AA Change: D1424N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: D1424N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
Predicted Primers PCR Primer
(F):5'- GGGAAAGCACCCTCTTAGAG -3'
(R):5'- GATCATGACAGACAAACTTCAGATC -3'

Sequencing Primer
(F):5'- ATAGGGTGGAGGGCTCATG -3'
(R):5'- TGACAGACAAACTTCAGATCATAGC -3'
Posted On2018-02-28