Incidental Mutation 'R6243:Bcat2'
ID505381
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Namebranched chain aminotransferase 2, mitochondrial
SynonymsEca40, Bcat-2
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6243 (G1)
Quality Score201.009
Status Validated
Chromosome7
Chromosomal Location45570153-45589711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45588267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 279 (V279A)
Ref Sequence ENSEMBL: ENSMUSP00000147628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
Predicted Effect probably benign
Transcript: ENSMUST00000033098
AA Change: V319A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: V319A

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120864
AA Change: V314A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: V314A

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209204
AA Change: V279A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000209410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209569
Predicted Effect probably benign
Transcript: ENSMUST00000210811
Predicted Effect probably benign
Transcript: ENSMUST00000211173
AA Change: V279A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45588260 missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45588007 missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45575498 missense probably benign
IGL03226:Bcat2 APN 7 45588354 missense probably damaging 1.00
P0022:Bcat2 UTSW 7 45588345 missense probably damaging 1.00
R1251:Bcat2 UTSW 7 45575986 missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45588368 missense possibly damaging 0.76
R5446:Bcat2 UTSW 7 45585145 missense possibly damaging 0.88
R6932:Bcat2 UTSW 7 45589321 missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45575485 missense probably benign 0.00
R7434:Bcat2 UTSW 7 45576005 splice site probably null
R7645:Bcat2 UTSW 7 45587963 missense probably benign 0.04
R7732:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R8140:Bcat2 UTSW 7 45588351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAAGTGTCTTGAGTCGTGG -3'
(R):5'- TTGCTACAGAAAGGGAGCCATG -3'

Sequencing Primer
(F):5'- AGTGGTGGAAGCCTGGC -3'
(R):5'- ATGAGGATGGGGCACTCC -3'
Posted On2018-02-28