Incidental Mutation 'R6243:Folr1'
ID505384
Institutional Source Beutler Lab
Gene Symbol Folr1
Ensembl Gene ENSMUSG00000001827
Gene Namefolate receptor 1 (adult)
SynonymsFolbp-1, folate receptor [a], Folbp1, folate-binding protein 1, FBP1
MMRRC Submission 044365-MU
Accession Numbers

Ncbi RefSeq: NM_001252552.1, NM_008034.3, NM_001252553.1, NM_001252554.1; MGI:95568

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101858331-101870788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101863965 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 41 (H41L)
Ref Sequence ENSEMBL: ENSMUSP00000115077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000123321] [ENSMUST00000123630] [ENSMUST00000124026] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000140068] [ENSMUST00000140584] [ENSMUST00000150184] [ENSMUST00000151706] [ENSMUST00000155311] [ENSMUST00000209334]
Predicted Effect probably damaging
Transcript: ENSMUST00000106981
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106982
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106983
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 4.2e-68 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106985
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106986
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123321
AA Change: H41L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114167
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 6e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000123630
AA Change: H41L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121947
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 4e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125298
Predicted Effect probably damaging
Transcript: ENSMUST00000126204
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 137 2.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134145
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 104 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140068
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 160 9.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140584
Predicted Effect probably damaging
Transcript: ENSMUST00000150184
AA Change: H41L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000151706
AA Change: H41L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 157 8.9e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155311
AA Change: H41L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115360
Gene: ENSMUSG00000001827
AA Change: H41L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 53 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Meta Mutation Damage Score 0.9105 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype Strain: 2383986
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]
Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Folr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Folr1 APN 7 101858740 missense probably benign 0.00
IGL02423:Folr1 APN 7 101858525 missense probably benign 0.00
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R1022:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1024:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1562:Folr1 UTSW 7 101858594 missense probably damaging 0.98
R2299:Folr1 UTSW 7 101863992 missense probably damaging 1.00
R3690:Folr1 UTSW 7 101858538 missense probably benign 0.06
R4746:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R4747:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R5319:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R6275:Folr1 UTSW 7 101859535 missense probably damaging 0.99
R7284:Folr1 UTSW 7 101859470 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAGCTGATAATATCACACTGGCAG -3'
(R):5'- TGGAGCTGAGCACACACTTG -3'

Sequencing Primer
(F):5'- ATATCACACTGGCAGTTGGC -3'
(R):5'- TGAGCACACACTTGGAGGTTC -3'
Posted On2018-02-28