Incidental Mutation 'R6243:Bsn'
ID505391
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 044365-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108107561 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 3098 (Y3098C)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: Y3098C
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: Y3098C

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124763
AA Change: Y326C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198370
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCAGCCAGTGAAGTCTGC -3'
(R):5'- TGTCTGACAGCGAGCTCAAC -3'

Sequencing Primer
(F):5'- AAGTCTGCCGTGGCTTC -3'
(R):5'- TCCAGGGTTGCACCACAC -3'
Posted On2018-02-28