Incidental Mutation 'R6243:Pik3r5'
ID505397
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68432121-68497849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68492000 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 289 (Y289H)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
Predicted Effect probably damaging
Transcript: ENSMUST00000021283
AA Change: Y289H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: Y289H

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Meta Mutation Damage Score 0.4396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68496194 missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68494547 missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68496001 missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68486626 splice site probably null
IGL01623:Pik3r5 APN 11 68486626 splice site probably null
IGL01878:Pik3r5 APN 11 68492530 missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68494171 missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68490855 missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68492726 missense probably benign 0.03
palmetto UTSW 11 68494233 missense probably damaging 1.00
Palmito UTSW 11 68492000 missense probably damaging 1.00
palms UTSW 11 68486622 critical splice donor site probably null
piranha UTSW 11 68486581 missense probably damaging 1.00
Serenoa_repens UTSW 11 68475424 nonsense probably null
IGL02799:Pik3r5 UTSW 11 68495947 missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68486622 critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68492803 missense probably benign
R0105:Pik3r5 UTSW 11 68490511 missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68490480 missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68494224 missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68494177 missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68492492 missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68493577 missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68492917 missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68493261 intron probably benign
R4716:Pik3r5 UTSW 11 68495204 missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68493638 missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68491964 missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68477468 missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68495977 missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68494233 missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68494251 missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68492270 missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68492318 missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68492675 missense probably benign
R6322:Pik3r5 UTSW 11 68492741 missense probably benign
R6420:Pik3r5 UTSW 11 68475424 nonsense probably null
R6505:Pik3r5 UTSW 11 68492789 missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68490617 missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68486581 missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68492943 missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68492590 missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68476351 missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68490498 missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68493657 missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7968:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
Z1177:Pik3r5 UTSW 11 68492896 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CGTCTACATGGTGCCGTAAAG -3'
(R):5'- CGTTTGCTCCAGGGCTATAG -3'

Sequencing Primer
(F):5'- CAGTAGCTGAGAGTCGGGTATCC -3'
(R):5'- TATAGTGCCCCTCACCCACTAGG -3'
Posted On2018-02-28