Incidental Mutation 'R6243:Mpeg1'
ID505413
Institutional Source Beutler Lab
Gene Symbol Mpeg1
Ensembl Gene ENSMUSG00000046805
Gene Namemacrophage expressed gene 1
SynonymsMPS1, Mpg-1
MMRRC Submission 044365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6243 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12460779-12465284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12462240 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 354 (H354R)
Ref Sequence ENSEMBL: ENSMUSP00000108573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
Predicted Effect probably benign
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000081035
AA Change: H354R

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: H354R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atg16l2 A C 7: 101,292,329 *404E probably null Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Mpeg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mpeg1 APN 19 12462710 missense probably benign 0.39
IGL00902:Mpeg1 APN 19 12461769 missense probably damaging 1.00
IGL01141:Mpeg1 APN 19 12462785 missense probably damaging 1.00
IGL02037:Mpeg1 APN 19 12463296 missense probably benign 0.04
IGL02447:Mpeg1 APN 19 12462792 missense probably damaging 1.00
IGL02448:Mpeg1 APN 19 12462609 missense probably benign
IGL02510:Mpeg1 APN 19 12461424 missense probably damaging 1.00
IGL03068:Mpeg1 APN 19 12462206 missense probably benign 0.01
R0128:Mpeg1 UTSW 19 12461223 missense probably benign 0.00
R0310:Mpeg1 UTSW 19 12461691 missense probably benign 0.00
R0312:Mpeg1 UTSW 19 12462403 missense probably damaging 1.00
R0522:Mpeg1 UTSW 19 12461759 missense probably damaging 0.99
R1356:Mpeg1 UTSW 19 12461325 missense probably damaging 0.98
R1396:Mpeg1 UTSW 19 12462804 missense probably damaging 1.00
R1436:Mpeg1 UTSW 19 12462459 missense probably damaging 0.98
R1497:Mpeg1 UTSW 19 12461247 missense probably benign 0.04
R1714:Mpeg1 UTSW 19 12462834 missense probably damaging 1.00
R1846:Mpeg1 UTSW 19 12463122 missense probably benign 0.00
R1856:Mpeg1 UTSW 19 12462356 missense probably benign 0.04
R1933:Mpeg1 UTSW 19 12462647 nonsense probably null
R1959:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1960:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1961:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R2240:Mpeg1 UTSW 19 12463038 missense probably damaging 0.98
R2474:Mpeg1 UTSW 19 12462249 missense probably damaging 1.00
R3430:Mpeg1 UTSW 19 12463128 missense probably benign 0.22
R4079:Mpeg1 UTSW 19 12462270 missense probably damaging 0.99
R4245:Mpeg1 UTSW 19 12462908 missense probably damaging 0.99
R4451:Mpeg1 UTSW 19 12463232 nonsense probably null
R4888:Mpeg1 UTSW 19 12463070 missense probably damaging 1.00
R4980:Mpeg1 UTSW 19 12461540 missense probably damaging 1.00
R5071:Mpeg1 UTSW 19 12461181 start codon destroyed probably null 0.02
R5089:Mpeg1 UTSW 19 12462997 missense probably benign 0.00
R5120:Mpeg1 UTSW 19 12461429 nonsense probably null
R5327:Mpeg1 UTSW 19 12461649 missense probably damaging 1.00
R5490:Mpeg1 UTSW 19 12461693 missense probably damaging 0.99
R5725:Mpeg1 UTSW 19 12462636 missense probably benign 0.13
R6147:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R6486:Mpeg1 UTSW 19 12462105 missense probably damaging 1.00
R6520:Mpeg1 UTSW 19 12461958 missense probably benign 0.04
R7139:Mpeg1 UTSW 19 12461714 missense probably benign 0.07
R7204:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R7310:Mpeg1 UTSW 19 12462251 missense probably damaging 0.99
R7665:Mpeg1 UTSW 19 12463094 missense probably damaging 1.00
R7674:Mpeg1 UTSW 19 12461387 missense probably benign
R8388:Mpeg1 UTSW 19 12462914 missense probably damaging 1.00
X0064:Mpeg1 UTSW 19 12461972 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACCTTAGAAACCTGGCAG -3'
(R):5'- ACGACTGTAACCCTCTTCATGG -3'

Sequencing Primer
(F):5'- GAAGGGCATCACTAACCACCTAGTG -3'
(R):5'- CCCTCTTCATGGGTCTGGGAG -3'
Posted On2018-02-28