Incidental Mutation 'R6244:Il1rl2'
ID 505416
Institutional Source Beutler Lab
Gene Symbol Il1rl2
Ensembl Gene ENSMUSG00000070942
Gene Name interleukin 1 receptor-like 2
Synonyms
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40324610-40367562 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40327566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 87 (L87M)
Ref Sequence ENSEMBL: ENSMUSP00000141507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095020] [ENSMUST00000193388] [ENSMUST00000194296]
AlphaFold Q9ERS7
Predicted Effect probably benign
Transcript: ENSMUST00000095020
AA Change: L87M

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092630
Gene: ENSMUSG00000070942
AA Change: L87M

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192551
Predicted Effect possibly damaging
Transcript: ENSMUST00000193388
AA Change: L87M

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141507
Gene: ENSMUSG00000070942
AA Change: L87M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 29 115 3.1e-10 SMART
Pfam:Ig_2 127 167 2.4e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194296
AA Change: L87M

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142248
Gene: ENSMUSG00000070942
AA Change: L87M

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and overtly normal and have normal skin in an unchallenged context. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Il1rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Il1rl2 APN 1 40356814 splice site probably null
IGL02490:Il1rl2 APN 1 40356812 splice site probably benign
IGL03201:Il1rl2 APN 1 40343040 missense possibly damaging 0.95
IGL03269:Il1rl2 APN 1 40365312 missense probably damaging 1.00
R0088:Il1rl2 UTSW 1 40365053 missense possibly damaging 0.87
R0418:Il1rl2 UTSW 1 40326502 missense unknown
R0504:Il1rl2 UTSW 1 40329056 missense probably benign 0.00
R1629:Il1rl2 UTSW 1 40356860 missense probably benign 0.02
R1679:Il1rl2 UTSW 1 40343160 missense probably benign 0.36
R1680:Il1rl2 UTSW 1 40351793 missense possibly damaging 0.61
R1892:Il1rl2 UTSW 1 40327534 missense probably damaging 1.00
R1938:Il1rl2 UTSW 1 40363324 missense probably damaging 1.00
R2020:Il1rl2 UTSW 1 40365214 missense probably damaging 0.98
R4193:Il1rl2 UTSW 1 40365048 missense probably damaging 1.00
R4364:Il1rl2 UTSW 1 40351791 missense probably benign
R4365:Il1rl2 UTSW 1 40351791 missense probably benign
R4657:Il1rl2 UTSW 1 40327310 intron probably benign
R4840:Il1rl2 UTSW 1 40327387 missense possibly damaging 0.84
R4890:Il1rl2 UTSW 1 40327310 intron probably benign
R5051:Il1rl2 UTSW 1 40343094 missense probably benign 0.03
R5239:Il1rl2 UTSW 1 40365095 missense probably benign 0.03
R5447:Il1rl2 UTSW 1 40329156 missense probably damaging 1.00
R6013:Il1rl2 UTSW 1 40351857 missense possibly damaging 0.82
R6162:Il1rl2 UTSW 1 40351878 missense probably damaging 1.00
R6798:Il1rl2 UTSW 1 40365240 missense probably damaging 1.00
R7667:Il1rl2 UTSW 1 40365253 missense probably damaging 0.99
R7855:Il1rl2 UTSW 1 40343119 missense probably damaging 1.00
R7857:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
R8255:Il1rl2 UTSW 1 40365311 missense probably damaging 1.00
R8903:Il1rl2 UTSW 1 40327370 critical splice acceptor site probably null
R9236:Il1rl2 UTSW 1 40329061 missense probably damaging 1.00
R9448:Il1rl2 UTSW 1 40327444 missense probably benign 0.36
R9485:Il1rl2 UTSW 1 40327310 intron probably benign
R9487:Il1rl2 UTSW 1 40327310 intron probably benign
R9621:Il1rl2 UTSW 1 40327310 intron probably benign
R9746:Il1rl2 UTSW 1 40365359 missense possibly damaging 0.94
Z1177:Il1rl2 UTSW 1 40327310 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCCAGATACGTGTGAGG -3'
(R):5'- CCTGTCCTTTCAGTACTTTAGAAAGC -3'

Sequencing Primer
(F):5'- ACGTGTGAGGACATTTTTATGCAC -3'
(R):5'- AGCAGTTGGAAACTTGTCTAGGC -3'
Posted On 2018-02-28