Incidental Mutation 'R6244:6430550D23Rik'
ID505427
Institutional Source Beutler Lab
Gene Symbol 6430550D23Rik
Ensembl Gene ENSMUSG00000074646
Gene NameRIKEN cDNA 6430550D23 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155973279-156007977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156003230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 113 (H113R)
Ref Sequence ENSEMBL: ENSMUSP00000120293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000039994] [ENSMUST00000086145] [ENSMUST00000088650] [ENSMUST00000094421] [ENSMUST00000109617] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000139116] [ENSMUST00000140657] [ENSMUST00000141437] [ENSMUST00000144686] [ENSMUST00000156993]
Predicted Effect probably benign
Transcript: ENSMUST00000006035
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039994
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086145
AA Change: H60R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000088650
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094421
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109617
AA Change: H146R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105246
Gene: ENSMUSG00000074646
AA Change: H146R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109619
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124812
AA Change: H60R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138025
Predicted Effect probably benign
Transcript: ENSMUST00000139116
SMART Domains Protein: ENSMUSP00000115643
Gene: ENSMUSG00000074646

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140657
SMART Domains Protein: ENSMUSP00000118982
Gene: ENSMUSG00000074646

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141437
SMART Domains Protein: ENSMUSP00000114957
Gene: ENSMUSG00000074646

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144686
AA Change: H113R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148191
Predicted Effect probably benign
Transcript: ENSMUST00000156993
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in 6430550D23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3408:6430550D23Rik UTSW 2 156003920 missense probably benign 0.34
R7357:6430550D23Rik UTSW 2 156003867 missense unknown
R7397:6430550D23Rik UTSW 2 156003928 missense unknown
R7453:6430550D23Rik UTSW 2 156003389 missense possibly damaging 0.83
R7530:6430550D23Rik UTSW 2 156003920 missense probably benign 0.34
R7757:6430550D23Rik UTSW 2 156003431 missense possibly damaging 0.66
X0064:6430550D23Rik UTSW 2 156003186 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGAAAACTCCCTGTCCCC -3'
(R):5'- AAGAAGCCATCTGGAGTGAC -3'

Sequencing Primer
(F):5'- CCCCACTCTGAGAATGTCTAAC -3'
(R):5'- GGAGTGACTCCCAATTCCC -3'
Posted On2018-02-28