Mutagenetix > Incidental Mutation

Incidental Mutation 'R6244:Kcnn3'

505431

Institutional Source

Beutler Lab

Gene Symbol

Kcnn3

Ensembl Gene

ENSMUSG00000000794

Gene Name

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3

Synonyms

small conductance calcium-activated potassium channel 3, SK3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.485) question?

Stock #

R6244 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89520164-89675132 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 89645523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 511 (Y511*)

Ref Sequence

ENSEMBL: ENSMUSP00000000811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000811]

AlphaFold

P58391

Predicted Effect

probably null
Transcript: ENSMUST00000000811
AA Change: Y511*

SMART Domains

Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: Y511*

Domain	Start	End	E-Value	Type
low complexity region	30	96	N/A	INTRINSIC
low complexity region	139	154	N/A	INTRINSIC
low complexity region	213	224	N/A	INTRINSIC
Pfam:SK_channel	270	383	3.1e-51	PFAM
Pfam:Ion_trans_2	462	548	2.2e-14	PFAM
CaMBD	562	638	1.04e-49	SMART
low complexity region	684	690	N/A	INTRINSIC
low complexity region	718	731	N/A	INTRINSIC

Meta Mutation Damage Score

0.9757

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,956,999	V1782A	probably benign	Het
6430550D23Rik	T	C	2: 156,003,230	H113R	possibly damaging	Het
Adgrf3	A	T	5: 30,197,533	M499K	probably benign	Het
Adgrv1	G	A	13: 81,106,931	T211I	probably damaging	Het
Adss	C	T	1: 177,776,829	E153K	probably benign	Het
Ago4	C	A	4: 126,511,487	G431V	possibly damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Atp2b4	T	A	1: 133,726,561	I769F	probably damaging	Het
Atp9a	T	C	2: 168,689,352		probably null	Het
Brap	C	A	5: 121,665,309	D173E	probably benign	Het
Brca2	G	T	5: 150,566,978	R3035L	probably benign	Het
Ccdc8	C	A	7: 16,996,251	P555Q	probably benign	Het
Ccser2	A	G	14: 36,940,718	S170P	probably benign	Het
Celsr2	T	C	3: 108,393,128	H860R	probably damaging	Het
Cenpc1	C	A	5: 86,046,385	R174M	probably damaging	Het
Cfap57	T	G	4: 118,579,410	I930L	probably damaging	Het
Cx3cr1	C	T	9: 120,051,694	R214H	probably damaging	Het
Cyp4f14	T	A	17: 32,906,317	H429L	probably benign	Het
D5Ertd579e	A	G	5: 36,615,276	F592L	probably damaging	Het
Ddb1	A	G	19: 10,625,923	E865G	probably damaging	Het
Ddx50	A	T	10: 62,621,566		probably null	Het
Dpp6	A	G	5: 27,049,628	T14A	probably damaging	Het
Echs1	C	A	7: 140,113,069	Q51H	possibly damaging	Het
Ecm2	A	T	13: 49,530,307	D587V	probably damaging	Het
Ect2l	A	T	10: 18,140,397	Y666N	possibly damaging	Het
Epha2	G	A	4: 141,316,912	G342S	probably benign	Het
Fbxo33	C	A	12: 59,206,079	K211N	probably benign	Het
Fchsd2	A	G	7: 101,259,776		probably null	Het
Fen1	A	G	19: 10,200,687	V131A	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Flnb	A	G	14: 7,892,092	E587G	probably damaging	Het
Foxd3	A	G	4: 99,657,240	T206A	possibly damaging	Het
Fut1	A	G	7: 45,619,306	E228G	possibly damaging	Het
Galnt13	T	C	2: 54,933,548	F379L	probably damaging	Het
Gcnt2	A	C	13: 40,861,241	E296A	probably damaging	Het
Gm7145	T	A	1: 117,986,140	C251S	probably damaging	Het
Gpam	G	A	19: 55,070,985	P810L	probably damaging	Het
Il1rl2	T	A	1: 40,327,566	L87M	possibly damaging	Het
Itgae	A	G	11: 73,145,601	S1122G	probably damaging	Het
Kcnh7	T	A	2: 63,182,226	D46V	probably damaging	Het
Kdm3b	T	A	18: 34,793,005	I66N	probably damaging	Het
Klk1b27	A	T	7: 44,054,550	H39L	probably benign	Het
Kmo	C	T	1: 175,659,695	T404I	possibly damaging	Het
Krt222	C	T	11: 99,235,058		probably null	Het
Magi3	G	C	3: 104,015,697	H1235D	probably benign	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Med15	G	A	16: 17,652,745	Q583*	probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh13	A	G	11: 67,362,501	M1488V	probably benign	Het
Naip2	A	T	13: 100,152,137	F1193L	probably damaging	Het
Nop58	T	A	1: 59,702,855	M181K	probably damaging	Het
Npepps	A	T	11: 97,213,790	V796D	probably damaging	Het
Nr1d1	A	G	11: 98,770,537	F301S	probably damaging	Het
Nynrin	G	A	14: 55,868,028	V832I	probably damaging	Het
Olfr1046	T	A	2: 86,217,222	T163S	possibly damaging	Het
Olfr1508	T	A	14: 52,463,895	Y38F	probably damaging	Het
Olfr320	A	T	11: 58,684,004	T44S	possibly damaging	Het
Olfr342	T	A	2: 36,528,341	C310S	probably benign	Het
Olfr61	C	A	7: 140,638,433	S244Y	probably damaging	Het
Phrf1	T	A	7: 141,237,673	C132S	probably damaging	Het
Plekhn1	T	C	4: 156,230,558		probably null	Het
Polr2a	G	A	11: 69,744,226	T569M	probably damaging	Het
Prr29	A	G	11: 106,376,632		probably null	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Sc5d	T	C	9: 42,255,421	E274G	probably benign	Het
Serpina1d	A	T	12: 103,764,828		probably null	Het
Serpinb11	T	A	1: 107,372,242	I106N	probably damaging	Het
Setd2	G	A	9: 110,548,665	R516K	probably damaging	Het
Sirt2	G	T	7: 28,787,797	C291F	probably damaging	Het
Stac3	T	C	10: 127,508,175	V314A	probably damaging	Het
Stat6	C	T	10: 127,657,712		probably null	Het
Strn3	A	G	12: 51,610,107	V712A	probably damaging	Het
Tmc5	G	T	7: 118,634,214	G84C	possibly damaging	Het
Tnik	C	A	3: 28,650,179	L996I	probably damaging	Het
Trim30d	G	T	7: 104,487,610	T129K	probably damaging	Het
Triml1	G	T	8: 43,138,756	Y188*	probably null	Het
Trpc7	A	G	13: 56,773,892	Y760H	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ubash3a	A	T	17: 31,239,272	Q575L	possibly damaging	Het
Usp49	T	A	17: 47,672,902	C61*	probably null	Het
Vmn2r18	A	T	5: 151,584,651	V336E	probably damaging	Het
Vwa8	T	C	14: 79,086,662	V1135A	probably benign	Het
Zcchc4	T	C	5: 52,783,161	V24A	probably benign	Het
Zfp354c	A	G	11: 50,814,971	Y426H	probably benign	Het

Other mutations in Kcnn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02263:Kcnn3	APN	3	89661218	missense	possibly damaging	0.73
IGL02444:Kcnn3	APN	3	89652052	missense	possibly damaging	0.50
IGL02500:Kcnn3	APN	3	89661112	splice site	probably benign
IGL02814:Kcnn3	APN	3	89521175	missense	possibly damaging	0.94
IGL02821:Kcnn3	APN	3	89662722	missense	possibly damaging	0.84
IGL02821:Kcnn3	APN	3	89520974	missense	possibly damaging	0.91
IGL02852:Kcnn3	APN	3	89609616	missense	probably damaging	0.96
IGL02942:Kcnn3	APN	3	89652076	missense	probably benign	0.00
IGL03118:Kcnn3	APN	3	89667161	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0032:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R0370:Kcnn3	UTSW	3	89667092	missense	probably damaging	0.98
R0619:Kcnn3	UTSW	3	89652030	missense	probably damaging	1.00
R1167:Kcnn3	UTSW	3	89564952	nonsense	probably null
R1255:Kcnn3	UTSW	3	89652109	missense	possibly damaging	0.84
R1643:Kcnn3	UTSW	3	89520497	missense	unknown
R1733:Kcnn3	UTSW	3	89652090	missense	probably benign	0.00
R1793:Kcnn3	UTSW	3	89609405	missense	probably benign	0.20
R1827:Kcnn3	UTSW	3	89520994	missense	possibly damaging	0.75
R1899:Kcnn3	UTSW	3	89520455	start gained	probably benign
R2055:Kcnn3	UTSW	3	89521375	missense	probably damaging	1.00
R2843:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R2922:Kcnn3	UTSW	3	89521022	missense	probably damaging	1.00
R4078:Kcnn3	UTSW	3	89661188	missense	possibly damaging	0.68
R4227:Kcnn3	UTSW	3	89521175	missense	possibly damaging	0.94
R4604:Kcnn3	UTSW	3	89520420	start gained	probably benign
R4814:Kcnn3	UTSW	3	89662724	missense	probably damaging	1.00
R4822:Kcnn3	UTSW	3	89667289	missense	possibly damaging	0.93
R5175:Kcnn3	UTSW	3	89609439	missense	probably damaging	1.00
R5211:Kcnn3	UTSW	3	89521231	missense	probably benign	0.04
R5438:Kcnn3	UTSW	3	89521298	missense	probably damaging	1.00
R5496:Kcnn3	UTSW	3	89609490	missense	possibly damaging	0.95
R7391:Kcnn3	UTSW	3	89609471	missense	probably benign	0.34
R7625:Kcnn3	UTSW	3	89609670	missense	probably damaging	0.99
R7834:Kcnn3	UTSW	3	89521354	missense	probably damaging	1.00
R8022:Kcnn3	UTSW	3	89609703	missense	possibly damaging	0.92
R8110:Kcnn3	UTSW	3	89661233	missense	probably damaging	0.99
R8220:Kcnn3	UTSW	3	89661241	missense	probably benign	0.14
R8787:Kcnn3	UTSW	3	89645450	missense	possibly damaging	0.93
R9124:Kcnn3	UTSW	3	89521229	missense	possibly damaging	0.47
R9256:Kcnn3	UTSW	3	89667100	missense	probably damaging	1.00
R9612:Kcnn3	UTSW	3	89609396	missense	probably benign	0.09
Z1088:Kcnn3	UTSW	3	89667130	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89520923	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89661136	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CACCACTGTGTGTTCCTCAG -3'
(R):5'- TGGTGGGCTCTGGAAACTAG -3'

Sequencing Primer
(F):5'- GTGTGTTCCTCAGTACCCCAC -3'
(R):5'- GGCTCTGGAAACTAGATTTGCAC -3'

Posted On

2018-02-28