Mutagenetix > Incidental Mutation

Incidental Mutation 'R6244:Cfap57'

505435

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

044435-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6244 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 118579410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 930 (I930L)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: I930L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: I930L

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: I930L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: I930L

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.0813

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,956,999	V1782A	probably benign	Het
6430550D23Rik	T	C	2: 156,003,230	H113R	possibly damaging	Het
Adgrf3	A	T	5: 30,197,533	M499K	probably benign	Het
Adgrv1	G	A	13: 81,106,931	T211I	probably damaging	Het
Adss	C	T	1: 177,776,829	E153K	probably benign	Het
Ago4	C	A	4: 126,511,487	G431V	possibly damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Atp2b4	T	A	1: 133,726,561	I769F	probably damaging	Het
Atp9a	T	C	2: 168,689,352		probably null	Het
Brap	C	A	5: 121,665,309	D173E	probably benign	Het
Brca2	G	T	5: 150,566,978	R3035L	probably benign	Het
Ccdc8	C	A	7: 16,996,251	P555Q	probably benign	Het
Ccser2	A	G	14: 36,940,718	S170P	probably benign	Het
Celsr2	T	C	3: 108,393,128	H860R	probably damaging	Het
Cenpc1	C	A	5: 86,046,385	R174M	probably damaging	Het
Cx3cr1	C	T	9: 120,051,694	R214H	probably damaging	Het
Cyp4f14	T	A	17: 32,906,317	H429L	probably benign	Het
D5Ertd579e	A	G	5: 36,615,276	F592L	probably damaging	Het
Ddb1	A	G	19: 10,625,923	E865G	probably damaging	Het
Ddx50	A	T	10: 62,621,566		probably null	Het
Dpp6	A	G	5: 27,049,628	T14A	probably damaging	Het
Echs1	C	A	7: 140,113,069	Q51H	possibly damaging	Het
Ecm2	A	T	13: 49,530,307	D587V	probably damaging	Het
Ect2l	A	T	10: 18,140,397	Y666N	possibly damaging	Het
Epha2	G	A	4: 141,316,912	G342S	probably benign	Het
Fbxo33	C	A	12: 59,206,079	K211N	probably benign	Het
Fchsd2	A	G	7: 101,259,776		probably null	Het
Fen1	A	G	19: 10,200,687	V131A	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Flnb	A	G	14: 7,892,092	E587G	probably damaging	Het
Foxd3	A	G	4: 99,657,240	T206A	possibly damaging	Het
Fut1	A	G	7: 45,619,306	E228G	possibly damaging	Het
Galnt13	T	C	2: 54,933,548	F379L	probably damaging	Het
Gcnt2	A	C	13: 40,861,241	E296A	probably damaging	Het
Gm7145	T	A	1: 117,986,140	C251S	probably damaging	Het
Gpam	G	A	19: 55,070,985	P810L	probably damaging	Het
Il1rl2	T	A	1: 40,327,566	L87M	possibly damaging	Het
Itgae	A	G	11: 73,145,601	S1122G	probably damaging	Het
Kcnh7	T	A	2: 63,182,226	D46V	probably damaging	Het
Kcnn3	T	G	3: 89,645,523	Y511*	probably null	Het
Kdm3b	T	A	18: 34,793,005	I66N	probably damaging	Het
Klk1b27	A	T	7: 44,054,550	H39L	probably benign	Het
Kmo	C	T	1: 175,659,695	T404I	possibly damaging	Het
Krt222	C	T	11: 99,235,058		probably null	Het
Magi3	G	C	3: 104,015,697	H1235D	probably benign	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Med15	G	A	16: 17,652,745	Q583*	probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh13	A	G	11: 67,362,501	M1488V	probably benign	Het
Naip2	A	T	13: 100,152,137	F1193L	probably damaging	Het
Nop58	T	A	1: 59,702,855	M181K	probably damaging	Het
Npepps	A	T	11: 97,213,790	V796D	probably damaging	Het
Nr1d1	A	G	11: 98,770,537	F301S	probably damaging	Het
Nynrin	G	A	14: 55,868,028	V832I	probably damaging	Het
Olfr1046	T	A	2: 86,217,222	T163S	possibly damaging	Het
Olfr1508	T	A	14: 52,463,895	Y38F	probably damaging	Het
Olfr320	A	T	11: 58,684,004	T44S	possibly damaging	Het
Olfr342	T	A	2: 36,528,341	C310S	probably benign	Het
Olfr61	C	A	7: 140,638,433	S244Y	probably damaging	Het
Phrf1	T	A	7: 141,237,673	C132S	probably damaging	Het
Plekhn1	T	C	4: 156,230,558		probably null	Het
Polr2a	G	A	11: 69,744,226	T569M	probably damaging	Het
Prr29	A	G	11: 106,376,632		probably null	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Sc5d	T	C	9: 42,255,421	E274G	probably benign	Het
Serpina1d	A	T	12: 103,764,828		probably null	Het
Serpinb11	T	A	1: 107,372,242	I106N	probably damaging	Het
Setd2	G	A	9: 110,548,665	R516K	probably damaging	Het
Sirt2	G	T	7: 28,787,797	C291F	probably damaging	Het
Stac3	T	C	10: 127,508,175	V314A	probably damaging	Het
Stat6	C	T	10: 127,657,712		probably null	Het
Strn3	A	G	12: 51,610,107	V712A	probably damaging	Het
Tmc5	G	T	7: 118,634,214	G84C	possibly damaging	Het
Tnik	C	A	3: 28,650,179	L996I	probably damaging	Het
Trim30d	G	T	7: 104,487,610	T129K	probably damaging	Het
Triml1	G	T	8: 43,138,756	Y188*	probably null	Het
Trpc7	A	G	13: 56,773,892	Y760H	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ubash3a	A	T	17: 31,239,272	Q575L	possibly damaging	Het
Usp49	T	A	17: 47,672,902	C61*	probably null	Het
Vmn2r18	A	T	5: 151,584,651	V336E	probably damaging	Het
Vwa8	T	C	14: 79,086,662	V1135A	probably benign	Het
Zcchc4	T	C	5: 52,783,161	V24A	probably benign	Het
Zfp354c	A	G	11: 50,814,971	Y426H	probably benign	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTTCTGCCACCAAGTCAG -3'
(R):5'- TCCCCAAAGTCCATGGATGTTG -3'

Sequencing Primer
(F):5'- TTCTGCCACCAAGTCAGGTAAATG -3'
(R):5'- CCAAAGTCCATGGATGTTGAGTGG -3'

Posted On

2018-02-28