Incidental Mutation 'R6244:Cfap57'
ID505435
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118579410 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 930 (I930L)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably damaging
Transcript: ENSMUST00000071972
AA Change: I930L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: I930L

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081921
AA Change: I930L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: I930L

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense not run
R7642:Cfap57 UTSW 4 118614931 missense not run
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTCTTCTGCCACCAAGTCAG -3'
(R):5'- TCCCCAAAGTCCATGGATGTTG -3'

Sequencing Primer
(F):5'- TTCTGCCACCAAGTCAGGTAAATG -3'
(R):5'- CCAAAGTCCATGGATGTTGAGTGG -3'
Posted On2018-02-28