Mutagenetix > Incidental Mutations

Incidental Mutation 'R6244:Ago4'

505436

Institutional Source

Beutler Lab

Gene Symbol

Ago4

Ensembl Gene

ENSMUSG00000042500

Gene Name

argonaute RISC catalytic subunit 4

Synonyms

argonaute 4, Eif2c4, 5730550L01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.501) question?

Stock #

R6244 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126489541-126533472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 126511487 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 431 (G431V)

Ref Sequence

ENSEMBL: ENSMUSP00000081312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084289]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084289
AA Change: G431V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: G431V

Domain	Start	End	E-Value	Type
Pfam:ArgoN	18	156	3.9e-28	PFAM
DUF1785	165	217	4.22e-24	SMART
PAZ	225	360	1.26e-3	SMART
Pfam:ArgoL2	365	412	1.2e-16	PFAM
Pfam:ArgoMid	421	503	8.6e-35	PFAM
Piwi	509	820	2.9e-130	SMART
Blast:Piwi	827	856	2e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122951

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,956,999	V1782A	probably benign	Het
6430550D23Rik	T	C	2: 156,003,230	H113R	possibly damaging	Het
Adgrf3	A	T	5: 30,197,533	M499K	probably benign	Het
Adgrv1	G	A	13: 81,106,931	T211I	probably damaging	Het
Adss	C	T	1: 177,776,829	E153K	probably benign	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Atp2b4	T	A	1: 133,726,561	I769F	probably damaging	Het
Atp9a	T	C	2: 168,689,352		probably null	Het
Brap	C	A	5: 121,665,309	D173E	probably benign	Het
Brca2	G	T	5: 150,566,978	R3035L	probably benign	Het
Ccdc8	C	A	7: 16,996,251	P555Q	probably benign	Het
Ccser2	A	G	14: 36,940,718	S170P	probably benign	Het
Celsr2	T	C	3: 108,393,128	H860R	probably damaging	Het
Cenpc1	C	A	5: 86,046,385	R174M	probably damaging	Het
Cfap57	T	G	4: 118,579,410	I930L	probably damaging	Het
Cx3cr1	C	T	9: 120,051,694	R214H	probably damaging	Het
Cyp4f14	T	A	17: 32,906,317	H429L	probably benign	Het
D5Ertd579e	A	G	5: 36,615,276	F592L	probably damaging	Het
Ddb1	A	G	19: 10,625,923	E865G	probably damaging	Het
Ddx50	A	T	10: 62,621,566		probably null	Het
Dpp6	A	G	5: 27,049,628	T14A	probably damaging	Het
Echs1	C	A	7: 140,113,069	Q51H	possibly damaging	Het
Ecm2	A	T	13: 49,530,307	D587V	probably damaging	Het
Ect2l	A	T	10: 18,140,397	Y666N	possibly damaging	Het
Epha2	G	A	4: 141,316,912	G342S	probably benign	Het
Fbxo33	C	A	12: 59,206,079	K211N	probably benign	Het
Fchsd2	A	G	7: 101,259,776		probably null	Het
Fen1	A	G	19: 10,200,687	V131A	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Flnb	A	G	14: 7,892,092	E587G	probably damaging	Het
Foxd3	A	G	4: 99,657,240	T206A	possibly damaging	Het
Fut1	A	G	7: 45,619,306	E228G	possibly damaging	Het
Galnt13	T	C	2: 54,933,548	F379L	probably damaging	Het
Gcnt2	A	C	13: 40,861,241	E296A	probably damaging	Het
Gm7145	T	A	1: 117,986,140	C251S	probably damaging	Het
Gpam	G	A	19: 55,070,985	P810L	probably damaging	Het
Il1rl2	T	A	1: 40,327,566	L87M	possibly damaging	Het
Itgae	A	G	11: 73,145,601	S1122G	probably damaging	Het
Kcnh7	T	A	2: 63,182,226	D46V	probably damaging	Het
Kcnn3	T	G	3: 89,645,523	Y511*	probably null	Het
Kdm3b	T	A	18: 34,793,005	I66N	probably damaging	Het
Klk1b27	A	T	7: 44,054,550	H39L	probably benign	Het
Kmo	C	T	1: 175,659,695	T404I	possibly damaging	Het
Krt222	C	T	11: 99,235,058		probably null	Het
Magi3	G	C	3: 104,015,697	H1235D	probably benign	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Med15	G	A	16: 17,652,745	Q583*	probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh13	A	G	11: 67,362,501	M1488V	probably benign	Het
Naip2	A	T	13: 100,152,137	F1193L	probably damaging	Het
Nop58	T	A	1: 59,702,855	M181K	probably damaging	Het
Npepps	A	T	11: 97,213,790	V796D	probably damaging	Het
Nr1d1	A	G	11: 98,770,537	F301S	probably damaging	Het
Nynrin	G	A	14: 55,868,028	V832I	probably damaging	Het
Olfr1046	T	A	2: 86,217,222	T163S	possibly damaging	Het
Olfr1508	T	A	14: 52,463,895	Y38F	probably damaging	Het
Olfr320	A	T	11: 58,684,004	T44S	possibly damaging	Het
Olfr342	T	A	2: 36,528,341	C310S	probably benign	Het
Olfr61	C	A	7: 140,638,433	S244Y	probably damaging	Het
Phrf1	T	A	7: 141,237,673	C132S	probably damaging	Het
Plekhn1	T	C	4: 156,230,558		probably null	Het
Polr2a	G	A	11: 69,744,226	T569M	probably damaging	Het
Prr29	A	G	11: 106,376,632		probably null	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Sc5d	T	C	9: 42,255,421	E274G	probably benign	Het
Serpina1d	A	T	12: 103,764,828		probably null	Het
Serpinb11	T	A	1: 107,372,242	I106N	probably damaging	Het
Setd2	G	A	9: 110,548,665	R516K	probably damaging	Het
Sirt2	G	T	7: 28,787,797	C291F	probably damaging	Het
Stac3	T	C	10: 127,508,175	V314A	probably damaging	Het
Stat6	C	T	10: 127,657,712		probably null	Het
Strn3	A	G	12: 51,610,107	V712A	probably damaging	Het
Tmc5	G	T	7: 118,634,214	G84C	possibly damaging	Het
Tnik	C	A	3: 28,650,179	L996I	probably damaging	Het
Trim30d	G	T	7: 104,487,610	T129K	probably damaging	Het
Triml1	G	T	8: 43,138,756	Y188*	probably null	Het
Trpc7	A	G	13: 56,773,892	Y760H	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ubash3a	A	T	17: 31,239,272	Q575L	possibly damaging	Het
Usp49	T	A	17: 47,672,902	C61*	probably null	Het
Vmn2r18	A	T	5: 151,584,651	V336E	probably damaging	Het
Vwa8	T	C	14: 79,086,662	V1135A	probably benign	Het
Zcchc4	T	C	5: 52,783,161	V24A	probably benign	Het
Zfp354c	A	G	11: 50,814,971	Y426H	probably benign	Het

Other mutations in Ago4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Ago4	APN	4	126517133	missense	probably benign	0.01
IGL00965:Ago4	APN	4	126493314	missense	probably benign	0.01
IGL01306:Ago4	APN	4	126515884	splice site	probably null
IGL01943:Ago4	APN	4	126517195	missense	probably damaging	1.00
IGL02079:Ago4	APN	4	126517084	missense	probably damaging	0.99
IGL02117:Ago4	APN	4	126516852	missense	probably benign	0.00
IGL02229:Ago4	APN	4	126511532	missense	probably benign	0.34
IGL02503:Ago4	APN	4	126496805	nonsense	probably null
IGL02504:Ago4	APN	4	126517439	missense	probably benign	0.00
IGL02975:Ago4	APN	4	126512519	critical splice donor site	probably null
IGL02837:Ago4	UTSW	4	126497300	missense	possibly damaging	0.73
R0129:Ago4	UTSW	4	126517183	missense	possibly damaging	0.85
R0142:Ago4	UTSW	4	126516932	missense	probably benign	0.24
R0480:Ago4	UTSW	4	126526077	missense	probably benign	0.00
R0533:Ago4	UTSW	4	126516860	missense	probably benign	0.00
R1014:Ago4	UTSW	4	126506785	missense	probably damaging	1.00
R1350:Ago4	UTSW	4	126507132	missense	probably benign	0.04
R1547:Ago4	UTSW	4	126511413	missense	probably benign	0.01
R1894:Ago4	UTSW	4	126512600	missense	probably benign	0.11
R1900:Ago4	UTSW	4	126516936	missense	probably benign	0.00
R2510:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R2511:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R4063:Ago4	UTSW	4	126515862	intron	probably benign
R4064:Ago4	UTSW	4	126515862	intron	probably benign
R4120:Ago4	UTSW	4	126496807	missense	probably damaging	1.00
R4916:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4917:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4918:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4941:Ago4	UTSW	4	126526054	missense	probably benign	0.00
R5169:Ago4	UTSW	4	126511727	missense	probably benign	0.06
R5262:Ago4	UTSW	4	126496764	missense	possibly damaging	0.66
R5385:Ago4	UTSW	4	126517556	missense	probably benign
R5757:Ago4	UTSW	4	126526084	missense	probably damaging	1.00
R6256:Ago4	UTSW	4	126520226	missense	probably damaging	1.00
R6389:Ago4	UTSW	4	126507244	missense	probably damaging	1.00
R6545:Ago4	UTSW	4	126512018	missense	probably benign	0.10
R7378:Ago4	UTSW	4	126511464	missense	probably benign
R7804:Ago4	UTSW	4	126512630	missense	probably benign	0.02
R7890:Ago4	UTSW	4	126526076	missense	probably benign	0.00
R7973:Ago4	UTSW	4	126526076	missense	probably benign	0.00
X0062:Ago4	UTSW	4	126515941	missense	probably benign	0.00
X0064:Ago4	UTSW	4	126517482	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- ACATAACTGTGGGCATCAGG -3'
(R):5'- AATGCTGCAGTATGGAGGCC -3'

Sequencing Primer
(F):5'- CATCAGGGGTTGGTGCCAG -3'
(R):5'- GCACCTTTGAATTTACCTGTAGTCAG -3'

Posted On

2018-02-28