Incidental Mutation 'R6244:Ago4'
ID 505436
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Name argonaute RISC catalytic subunit 4
Synonyms Eif2c4, 5730550L01Rik, argonaute 4
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126383334-126427265 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126405280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 431 (G431V)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
AlphaFold Q8CJF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084289
AA Change: G431V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: G431V

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Meta Mutation Damage Score 0.5980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik T C 2: 155,845,150 (GRCm39) H113R possibly damaging Het
Adgrf3 A T 5: 30,402,531 (GRCm39) M499K probably benign Het
Adgrv1 G A 13: 81,255,050 (GRCm39) T211I probably damaging Het
Adss2 C T 1: 177,604,395 (GRCm39) E153K probably benign Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Atp2b4 T A 1: 133,654,299 (GRCm39) I769F probably damaging Het
Atp9a T C 2: 168,531,272 (GRCm39) probably null Het
Bltp1 T C 3: 37,011,148 (GRCm39) V1782A probably benign Het
Brap C A 5: 121,803,372 (GRCm39) D173E probably benign Het
Brca2 G T 5: 150,490,443 (GRCm39) R3035L probably benign Het
Ccdc8 C A 7: 16,730,176 (GRCm39) P555Q probably benign Het
Ccser2 A G 14: 36,662,675 (GRCm39) S170P probably benign Het
Celsr2 T C 3: 108,300,444 (GRCm39) H860R probably damaging Het
Cenpc1 C A 5: 86,194,244 (GRCm39) R174M probably damaging Het
Cfap57 T G 4: 118,436,607 (GRCm39) I930L probably damaging Het
Cx3cr1 C T 9: 119,880,760 (GRCm39) R214H probably damaging Het
Cyp4f14 T A 17: 33,125,291 (GRCm39) H429L probably benign Het
D5Ertd579e A G 5: 36,772,620 (GRCm39) F592L probably damaging Het
Ddb1 A G 19: 10,603,287 (GRCm39) E865G probably damaging Het
Ddx50 A T 10: 62,457,345 (GRCm39) probably null Het
Dpp6 A G 5: 27,254,626 (GRCm39) T14A probably damaging Het
Echs1 C A 7: 139,692,982 (GRCm39) Q51H possibly damaging Het
Ecm2 A T 13: 49,683,783 (GRCm39) D587V probably damaging Het
Ect2l A T 10: 18,016,145 (GRCm39) Y666N possibly damaging Het
Epha2 G A 4: 141,044,223 (GRCm39) G342S probably benign Het
Fbxo33 C A 12: 59,252,865 (GRCm39) K211N probably benign Het
Fchsd2 A G 7: 100,908,983 (GRCm39) probably null Het
Fen1 A G 19: 10,178,051 (GRCm39) V131A probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,545,477 (GRCm39) T206A possibly damaging Het
Fut1 A G 7: 45,268,730 (GRCm39) E228G possibly damaging Het
Galnt13 T C 2: 54,823,560 (GRCm39) F379L probably damaging Het
Gcnt2 A C 13: 41,014,717 (GRCm39) E296A probably damaging Het
Gm7145 T A 1: 117,913,870 (GRCm39) C251S probably damaging Het
Gpam G A 19: 55,059,417 (GRCm39) P810L probably damaging Het
Il1rl2 T A 1: 40,366,726 (GRCm39) L87M possibly damaging Het
Itgae A G 11: 73,036,427 (GRCm39) S1122G probably damaging Het
Kcnh7 T A 2: 63,012,570 (GRCm39) D46V probably damaging Het
Kcnn3 T G 3: 89,552,830 (GRCm39) Y511* probably null Het
Kdm3b T A 18: 34,926,058 (GRCm39) I66N probably damaging Het
Klk1b27 A T 7: 43,703,974 (GRCm39) H39L probably benign Het
Kmo C T 1: 175,487,261 (GRCm39) T404I possibly damaging Het
Krt222 C T 11: 99,125,884 (GRCm39) probably null Het
Magi3 G C 3: 103,923,013 (GRCm39) H1235D probably benign Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Med15 G A 16: 17,470,609 (GRCm39) Q583* probably null Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh13 A G 11: 67,253,327 (GRCm39) M1488V probably benign Het
Naip2 A T 13: 100,288,645 (GRCm39) F1193L probably damaging Het
Nop58 T A 1: 59,742,014 (GRCm39) M181K probably damaging Het
Npepps A T 11: 97,104,616 (GRCm39) V796D probably damaging Het
Nr1d1 A G 11: 98,661,363 (GRCm39) F301S probably damaging Het
Nynrin G A 14: 56,105,485 (GRCm39) V832I probably damaging Het
Or13a28 C A 7: 140,218,346 (GRCm39) S244Y probably damaging Het
Or1j14 T A 2: 36,418,353 (GRCm39) C310S probably benign Het
Or2ak7 A T 11: 58,574,830 (GRCm39) T44S possibly damaging Het
Or4e1 T A 14: 52,701,352 (GRCm39) Y38F probably damaging Het
Or8k1 T A 2: 86,047,566 (GRCm39) T163S possibly damaging Het
Phrf1 T A 7: 140,817,586 (GRCm39) C132S probably damaging Het
Plekhn1 T C 4: 156,315,015 (GRCm39) probably null Het
Polr2a G A 11: 69,635,052 (GRCm39) T569M probably damaging Het
Prr29 A G 11: 106,267,458 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Sc5d T C 9: 42,166,717 (GRCm39) E274G probably benign Het
Serpina1d A T 12: 103,731,087 (GRCm39) probably null Het
Serpinb11 T A 1: 107,299,972 (GRCm39) I106N probably damaging Het
Setd2 G A 9: 110,377,733 (GRCm39) R516K probably damaging Het
Sirt2 G T 7: 28,487,222 (GRCm39) C291F probably damaging Het
Stac3 T C 10: 127,344,044 (GRCm39) V314A probably damaging Het
Stat6 C T 10: 127,493,581 (GRCm39) probably null Het
Strn3 A G 12: 51,656,890 (GRCm39) V712A probably damaging Het
Tmc5 G T 7: 118,233,437 (GRCm39) G84C possibly damaging Het
Tnik C A 3: 28,704,328 (GRCm39) L996I probably damaging Het
Trim30d G T 7: 104,136,817 (GRCm39) T129K probably damaging Het
Triml1 G T 8: 43,591,793 (GRCm39) Y188* probably null Het
Trpc7 A G 13: 56,921,705 (GRCm39) Y760H probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ubash3a A T 17: 31,458,246 (GRCm39) Q575L possibly damaging Het
Usp49 T A 17: 47,983,827 (GRCm39) C61* probably null Het
Vmn2r18 A T 5: 151,508,116 (GRCm39) V336E probably damaging Het
Vwa8 T C 14: 79,324,102 (GRCm39) V1135A probably benign Het
Zcchc4 T C 5: 52,940,503 (GRCm39) V24A probably benign Het
Zfp354c A G 11: 50,705,798 (GRCm39) Y426H probably benign Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126,410,926 (GRCm39) missense probably benign 0.01
IGL00965:Ago4 APN 4 126,387,107 (GRCm39) missense probably benign 0.01
IGL01306:Ago4 APN 4 126,409,677 (GRCm39) splice site probably null
IGL01943:Ago4 APN 4 126,410,988 (GRCm39) missense probably damaging 1.00
IGL02079:Ago4 APN 4 126,410,877 (GRCm39) missense probably damaging 0.99
IGL02117:Ago4 APN 4 126,410,645 (GRCm39) missense probably benign 0.00
IGL02229:Ago4 APN 4 126,405,325 (GRCm39) missense probably benign 0.34
IGL02503:Ago4 APN 4 126,390,598 (GRCm39) nonsense probably null
IGL02504:Ago4 APN 4 126,411,232 (GRCm39) missense probably benign 0.00
IGL02975:Ago4 APN 4 126,406,312 (GRCm39) critical splice donor site probably null
BB010:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
BB020:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126,391,093 (GRCm39) missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126,410,976 (GRCm39) missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126,410,725 (GRCm39) missense probably benign 0.24
R0480:Ago4 UTSW 4 126,419,870 (GRCm39) missense probably benign 0.00
R0533:Ago4 UTSW 4 126,410,653 (GRCm39) missense probably benign 0.00
R1014:Ago4 UTSW 4 126,400,578 (GRCm39) missense probably damaging 1.00
R1350:Ago4 UTSW 4 126,400,925 (GRCm39) missense probably benign 0.04
R1547:Ago4 UTSW 4 126,405,206 (GRCm39) missense probably benign 0.01
R1894:Ago4 UTSW 4 126,406,393 (GRCm39) missense probably benign 0.11
R1900:Ago4 UTSW 4 126,410,729 (GRCm39) missense probably benign 0.00
R2510:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R2511:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R4063:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4064:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4120:Ago4 UTSW 4 126,390,600 (GRCm39) missense probably damaging 1.00
R4916:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4917:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4918:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4941:Ago4 UTSW 4 126,419,847 (GRCm39) missense probably benign 0.00
R5169:Ago4 UTSW 4 126,405,520 (GRCm39) missense probably benign 0.06
R5262:Ago4 UTSW 4 126,390,557 (GRCm39) missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126,411,349 (GRCm39) missense probably benign
R5757:Ago4 UTSW 4 126,419,877 (GRCm39) missense probably damaging 1.00
R6256:Ago4 UTSW 4 126,414,019 (GRCm39) missense probably damaging 1.00
R6389:Ago4 UTSW 4 126,401,037 (GRCm39) missense probably damaging 1.00
R6545:Ago4 UTSW 4 126,405,811 (GRCm39) missense probably benign 0.10
R7378:Ago4 UTSW 4 126,405,257 (GRCm39) missense probably benign
R7804:Ago4 UTSW 4 126,406,423 (GRCm39) missense probably benign 0.02
R7890:Ago4 UTSW 4 126,419,869 (GRCm39) missense probably benign 0.00
R7933:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
R8824:Ago4 UTSW 4 126,400,977 (GRCm39) missense probably benign 0.04
R8852:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R8860:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R9023:Ago4 UTSW 4 126,400,596 (GRCm39) missense probably damaging 1.00
R9127:Ago4 UTSW 4 126,400,904 (GRCm39) missense probably damaging 1.00
R9138:Ago4 UTSW 4 126,414,073 (GRCm39) nonsense probably null
R9447:Ago4 UTSW 4 126,402,151 (GRCm39) missense probably benign 0.13
X0062:Ago4 UTSW 4 126,409,734 (GRCm39) missense probably benign 0.00
X0064:Ago4 UTSW 4 126,411,275 (GRCm39) missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126,413,983 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATAACTGTGGGCATCAGG -3'
(R):5'- AATGCTGCAGTATGGAGGCC -3'

Sequencing Primer
(F):5'- CATCAGGGGTTGGTGCCAG -3'
(R):5'- GCACCTTTGAATTTACCTGTAGTCAG -3'
Posted On 2018-02-28