Mutagenetix > Incidental Mutations

Incidental Mutation 'R6244:Epha2'

505437

Institutional Source

Beutler Lab

Gene Symbol

Epha2

Ensembl Gene

ENSMUSG00000006445

Gene Name

Eph receptor A2

Synonyms

Myk2, Eck, Sek-2, Sek2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.729) question?

Stock #

R6244 (G1)

Quality Score

147.008

Status

Not validated

Chromosome

Chromosomal Location

141301240-141329384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141316912 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 342 (G342S)

Ref Sequence

ENSEMBL: ENSMUSP00000006614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006614]

Predicted Effect

probably benign
Transcript: ENSMUST00000006614
AA Change: G342S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: G342S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
EPH_lbd	27	200	1.31e-112	SMART
FN3	330	420	1.16e-6	SMART
FN3	437	517	3.73e-10	SMART
Pfam:EphA2_TM	538	611	5.9e-22	PFAM
TyrKc	614	872	2.23e-135	SMART
SAM	902	969	1.5e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149002

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,956,999	V1782A	probably benign	Het
6430550D23Rik	T	C	2: 156,003,230	H113R	possibly damaging	Het
Adgrf3	A	T	5: 30,197,533	M499K	probably benign	Het
Adgrv1	G	A	13: 81,106,931	T211I	probably damaging	Het
Adss	C	T	1: 177,776,829	E153K	probably benign	Het
Ago4	C	A	4: 126,511,487	G431V	possibly damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Atp2b4	T	A	1: 133,726,561	I769F	probably damaging	Het
Atp9a	T	C	2: 168,689,352		probably null	Het
Brap	C	A	5: 121,665,309	D173E	probably benign	Het
Brca2	G	T	5: 150,566,978	R3035L	probably benign	Het
Ccdc8	C	A	7: 16,996,251	P555Q	probably benign	Het
Ccser2	A	G	14: 36,940,718	S170P	probably benign	Het
Celsr2	T	C	3: 108,393,128	H860R	probably damaging	Het
Cenpc1	C	A	5: 86,046,385	R174M	probably damaging	Het
Cfap57	T	G	4: 118,579,410	I930L	probably damaging	Het
Cx3cr1	C	T	9: 120,051,694	R214H	probably damaging	Het
Cyp4f14	T	A	17: 32,906,317	H429L	probably benign	Het
D5Ertd579e	A	G	5: 36,615,276	F592L	probably damaging	Het
Ddb1	A	G	19: 10,625,923	E865G	probably damaging	Het
Ddx50	A	T	10: 62,621,566		probably null	Het
Dpp6	A	G	5: 27,049,628	T14A	probably damaging	Het
Echs1	C	A	7: 140,113,069	Q51H	possibly damaging	Het
Ecm2	A	T	13: 49,530,307	D587V	probably damaging	Het
Ect2l	A	T	10: 18,140,397	Y666N	possibly damaging	Het
Fbxo33	C	A	12: 59,206,079	K211N	probably benign	Het
Fchsd2	A	G	7: 101,259,776		probably null	Het
Fen1	A	G	19: 10,200,687	V131A	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Flnb	A	G	14: 7,892,092	E587G	probably damaging	Het
Foxd3	A	G	4: 99,657,240	T206A	possibly damaging	Het
Fut1	A	G	7: 45,619,306	E228G	possibly damaging	Het
Galnt13	T	C	2: 54,933,548	F379L	probably damaging	Het
Gcnt2	A	C	13: 40,861,241	E296A	probably damaging	Het
Gm7145	T	A	1: 117,986,140	C251S	probably damaging	Het
Gpam	G	A	19: 55,070,985	P810L	probably damaging	Het
Il1rl2	T	A	1: 40,327,566	L87M	possibly damaging	Het
Itgae	A	G	11: 73,145,601	S1122G	probably damaging	Het
Kcnh7	T	A	2: 63,182,226	D46V	probably damaging	Het
Kcnn3	T	G	3: 89,645,523	Y511*	probably null	Het
Kdm3b	T	A	18: 34,793,005	I66N	probably damaging	Het
Klk1b27	A	T	7: 44,054,550	H39L	probably benign	Het
Kmo	C	T	1: 175,659,695	T404I	possibly damaging	Het
Krt222	C	T	11: 99,235,058		probably null	Het
Magi3	G	C	3: 104,015,697	H1235D	probably benign	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Med15	G	A	16: 17,652,745	Q583*	probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh13	A	G	11: 67,362,501	M1488V	probably benign	Het
Naip2	A	T	13: 100,152,137	F1193L	probably damaging	Het
Nop58	T	A	1: 59,702,855	M181K	probably damaging	Het
Npepps	A	T	11: 97,213,790	V796D	probably damaging	Het
Nr1d1	A	G	11: 98,770,537	F301S	probably damaging	Het
Nynrin	G	A	14: 55,868,028	V832I	probably damaging	Het
Olfr1046	T	A	2: 86,217,222	T163S	possibly damaging	Het
Olfr1508	T	A	14: 52,463,895	Y38F	probably damaging	Het
Olfr320	A	T	11: 58,684,004	T44S	possibly damaging	Het
Olfr342	T	A	2: 36,528,341	C310S	probably benign	Het
Olfr61	C	A	7: 140,638,433	S244Y	probably damaging	Het
Phrf1	T	A	7: 141,237,673	C132S	probably damaging	Het
Plekhn1	T	C	4: 156,230,558		probably null	Het
Polr2a	G	A	11: 69,744,226	T569M	probably damaging	Het
Prr29	A	G	11: 106,376,632		probably null	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Sc5d	T	C	9: 42,255,421	E274G	probably benign	Het
Serpina1d	A	T	12: 103,764,828		probably null	Het
Serpinb11	T	A	1: 107,372,242	I106N	probably damaging	Het
Setd2	G	A	9: 110,548,665	R516K	probably damaging	Het
Sirt2	G	T	7: 28,787,797	C291F	probably damaging	Het
Stac3	T	C	10: 127,508,175	V314A	probably damaging	Het
Stat6	C	T	10: 127,657,712		probably null	Het
Strn3	A	G	12: 51,610,107	V712A	probably damaging	Het
Tmc5	G	T	7: 118,634,214	G84C	possibly damaging	Het
Tnik	C	A	3: 28,650,179	L996I	probably damaging	Het
Trim30d	G	T	7: 104,487,610	T129K	probably damaging	Het
Triml1	G	T	8: 43,138,756	Y188*	probably null	Het
Trpc7	A	G	13: 56,773,892	Y760H	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ubash3a	A	T	17: 31,239,272	Q575L	possibly damaging	Het
Usp49	T	A	17: 47,672,902	C61*	probably null	Het
Vmn2r18	A	T	5: 151,584,651	V336E	probably damaging	Het
Vwa8	T	C	14: 79,086,662	V1135A	probably benign	Het
Zcchc4	T	C	5: 52,783,161	V24A	probably benign	Het
Zfp354c	A	G	11: 50,814,971	Y426H	probably benign	Het

Other mutations in Epha2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02148:Epha2	APN	4	141318524	missense	probably damaging	1.00
IGL02812:Epha2	APN	4	141318919	splice site	probably benign
IGL03377:Epha2	APN	4	141322412	missense	probably benign	0.08
R0165:Epha2	UTSW	4	141321892	critical splice donor site	probably null
R0321:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R1584:Epha2	UTSW	4	141322047	splice site	probably null
R1586:Epha2	UTSW	4	141318605	splice site	probably benign
R1695:Epha2	UTSW	4	141306517	missense	possibly damaging	0.74
R1721:Epha2	UTSW	4	141322652	missense	probably damaging	1.00
R1731:Epha2	UTSW	4	141321752	missense	possibly damaging	0.81
R1813:Epha2	UTSW	4	141308546	missense	possibly damaging	0.86
R1875:Epha2	UTSW	4	141308979	missense	probably benign	0.02
R2226:Epha2	UTSW	4	141321237	missense	probably damaging	1.00
R2314:Epha2	UTSW	4	141319014	missense	probably damaging	1.00
R2342:Epha2	UTSW	4	141323531	missense	probably benign	0.00
R3872:Epha2	UTSW	4	141308405	missense	probably damaging	1.00
R3927:Epha2	UTSW	4	141306550	missense	probably damaging	1.00
R4688:Epha2	UTSW	4	141318981	missense	probably benign
R4795:Epha2	UTSW	4	141322416	splice site	probably null
R4974:Epha2	UTSW	4	141321705	missense	probably damaging	0.99
R5055:Epha2	UTSW	4	141309069	missense	probably benign	0.09
R5123:Epha2	UTSW	4	141308865	missense	possibly damaging	0.71
R5424:Epha2	UTSW	4	141318940	nonsense	probably null
R5522:Epha2	UTSW	4	141308556	missense	probably damaging	1.00
R5657:Epha2	UTSW	4	141323494	missense	probably damaging	1.00
R5717:Epha2	UTSW	4	141322071	missense	probably benign
R5864:Epha2	UTSW	4	141308427	missense	probably damaging	0.98
R6151:Epha2	UTSW	4	141318480	critical splice acceptor site	probably null
R6288:Epha2	UTSW	4	141317033	missense	probably benign	0.01
R6696:Epha2	UTSW	4	141321539	missense	probably benign
R6817:Epha2	UTSW	4	141308994	missense	probably damaging	0.98
R6875:Epha2	UTSW	4	141328468	missense	probably damaging	1.00
R6910:Epha2	UTSW	4	141321513	missense	probably damaging	1.00
R6925:Epha2	UTSW	4	141308757	missense	probably benign
R7330:Epha2	UTSW	4	141308453	missense	probably benign	0.00
R7977:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R7987:Epha2	UTSW	4	141308480	missense	probably damaging	1.00
R8081:Epha2	UTSW	4	141322294	missense	probably damaging	1.00
RF024:Epha2	UTSW	4	141323406	critical splice acceptor site	unknown
Z1177:Epha2	UTSW	4	141318998	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTCCATGTCTTGCACACGTG -3'
(R):5'- CAGCGAAGGTATAGTTCATGTGG -3'

Sequencing Primer
(F):5'- CGTGAGTCTTACAGAGATCCAG -3'
(R):5'- AGGTCACTGACTGTCACACTCG -3'

Posted On

2018-02-28