Incidental Mutation 'R6244:Brap'
ID505443
Institutional Source Beutler Lab
Gene Symbol Brap
Ensembl Gene ENSMUSG00000029458
Gene NameBRCA1 associated protein
Synonyms3010002G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121660563-121687256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121665309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000143043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000031414] [ENSMUST00000111765] [ENSMUST00000111770] [ENSMUST00000140996] [ENSMUST00000142701] [ENSMUST00000195952]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031414
SMART Domains Protein: ENSMUSP00000031414
Gene: ENSMUSG00000029458

DomainStartEndE-ValueType
Pfam:BRAP2 153 251 3.7e-38 PFAM
RING 263 302 7.92e-8 SMART
ZnF_UBP 315 364 1.68e-25 SMART
coiled coil region 430 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111765
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458

DomainStartEndE-ValueType
Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111770
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127703
SMART Domains Protein: ENSMUSP00000118574
Gene: ENSMUSG00000029458

DomainStartEndE-ValueType
Pfam:BRAP2 1 39 6.3e-13 PFAM
RING 46 85 7.92e-8 SMART
ZnF_UBP 98 147 1.68e-25 SMART
coiled coil region 213 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect probably benign
Transcript: ENSMUST00000140996
Predicted Effect probably benign
Transcript: ENSMUST00000142701
AA Change: D173E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143043
Gene: ENSMUSG00000029458
AA Change: D173E

DomainStartEndE-ValueType
Pfam:BRAP2 103 175 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148052
Predicted Effect probably benign
Transcript: ENSMUST00000195952
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis and subtle defects in cell cycle-dependent nuclear movement in neural progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Brap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Brap APN 5 121665227 missense probably damaging 1.00
IGL01672:Brap APN 5 121678845 unclassified probably benign
IGL01889:Brap APN 5 121660818 missense probably benign 0.00
IGL01977:Brap APN 5 121678847 unclassified probably benign
IGL01978:Brap APN 5 121678847 unclassified probably benign
IGL01996:Brap APN 5 121678847 unclassified probably benign
IGL02499:Brap APN 5 121679871 missense probably damaging 0.99
IGL03137:Brap APN 5 121665093 splice site probably benign
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1624:Brap UTSW 5 121682859 missense possibly damaging 0.65
R1709:Brap UTSW 5 121665290 critical splice donor site probably null
R2056:Brap UTSW 5 121663466 missense probably damaging 1.00
R2109:Brap UTSW 5 121663359 missense possibly damaging 0.63
R3196:Brap UTSW 5 121665196 missense possibly damaging 0.70
R4591:Brap UTSW 5 121662050 missense probably null 1.00
R4744:Brap UTSW 5 121662130 missense probably damaging 1.00
R4924:Brap UTSW 5 121665255 missense probably damaging 1.00
R5000:Brap UTSW 5 121662026 nonsense probably null
R5702:Brap UTSW 5 121665143 missense probably damaging 1.00
R5893:Brap UTSW 5 121679342 nonsense probably null
R6266:Brap UTSW 5 121685265 missense probably benign 0.00
R6726:Brap UTSW 5 121675302 missense probably damaging 1.00
R7765:Brap UTSW 5 121662129 missense probably damaging 1.00
R7995:Brap UTSW 5 121682846 missense not run
X0003:Brap UTSW 5 121679256 missense probably damaging 1.00
Z1176:Brap UTSW 5 121675377 missense not run
Predicted Primers PCR Primer
(F):5'- CCTCCCTAAAAGAAGACGTTCGG -3'
(R):5'- GATTTGAACTCCGGACCTTCG -3'

Sequencing Primer
(F):5'- AAGACGTTCGGCGCAGTG -3'
(R):5'- ACCTTCGGAAGAGCAGTCG -3'
Posted On2018-02-28