Incidental Mutation 'R6244:Vmn2r18'
ID505445
Institutional Source Beutler Lab
Gene Symbol Vmn2r18
Ensembl Gene ENSMUSG00000091794
Gene Namevomeronasal 2, receptor 18
SynonymsEG632671
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location151561661-151586906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151584651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 336 (V336E)
Ref Sequence ENSEMBL: ENSMUSP00000127506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165928]
Predicted Effect probably damaging
Transcript: ENSMUST00000165928
AA Change: V336E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127506
Gene: ENSMUSG00000091794
AA Change: V336E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 403 5.7e-39 PFAM
Pfam:NCD3G 446 499 5.5e-20 PFAM
Pfam:7tm_3 531 767 5e-53 PFAM
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Npepps A T 11: 97,213,790 V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Vmn2r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Vmn2r18 APN 5 151572831 missense probably damaging 0.99
IGL01564:Vmn2r18 APN 5 151585168 missense possibly damaging 0.69
IGL01602:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01605:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01619:Vmn2r18 APN 5 151586764 missense probably benign 0.25
IGL02177:Vmn2r18 APN 5 151586809 missense possibly damaging 0.76
IGL02682:Vmn2r18 APN 5 151584637 missense probably damaging 0.99
IGL02751:Vmn2r18 APN 5 151584607 missense probably benign 0.09
IGL02977:Vmn2r18 APN 5 151586684 missense probably damaging 1.00
R0089:Vmn2r18 UTSW 5 151584804 missense probably benign 0.00
R0282:Vmn2r18 UTSW 5 151585203 missense probably benign 0.02
R0529:Vmn2r18 UTSW 5 151562523 missense probably damaging 0.99
R0812:Vmn2r18 UTSW 5 151572930 splice site probably benign
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1506:Vmn2r18 UTSW 5 151575634 intron probably null
R1562:Vmn2r18 UTSW 5 151586836 missense probably benign 0.12
R1637:Vmn2r18 UTSW 5 151584757 missense probably damaging 1.00
R1651:Vmn2r18 UTSW 5 151561999 missense probably damaging 1.00
R1883:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1884:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1914:Vmn2r18 UTSW 5 151575821 missense probably benign 0.02
R2051:Vmn2r18 UTSW 5 151562551 missense possibly damaging 0.90
R2056:Vmn2r18 UTSW 5 151584695 missense probably damaging 0.98
R2252:Vmn2r18 UTSW 5 151584976 missense possibly damaging 0.59
R2265:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2266:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2267:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2843:Vmn2r18 UTSW 5 151562284 missense probably damaging 1.00
R3023:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R3694:Vmn2r18 UTSW 5 151584568 missense probably benign 0.00
R3763:Vmn2r18 UTSW 5 151585179 missense probably damaging 1.00
R3816:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R4007:Vmn2r18 UTSW 5 151585246 missense probably damaging 0.99
R4152:Vmn2r18 UTSW 5 151562265 missense probably damaging 1.00
R4308:Vmn2r18 UTSW 5 151584803 nonsense probably null
R4362:Vmn2r18 UTSW 5 151572903 missense probably damaging 1.00
R4618:Vmn2r18 UTSW 5 151584959 missense possibly damaging 0.64
R4716:Vmn2r18 UTSW 5 151562137 missense possibly damaging 0.87
R4817:Vmn2r18 UTSW 5 151585432 intron probably null
R5111:Vmn2r18 UTSW 5 151562448 missense possibly damaging 0.85
R5692:Vmn2r18 UTSW 5 151562259 missense possibly damaging 0.65
R6115:Vmn2r18 UTSW 5 151584997 missense possibly damaging 0.81
R6595:Vmn2r18 UTSW 5 151562424 missense probably damaging 1.00
R6997:Vmn2r18 UTSW 5 151561873 missense possibly damaging 0.95
R7227:Vmn2r18 UTSW 5 151572799 missense probably damaging 1.00
R7349:Vmn2r18 UTSW 5 151562217 nonsense probably null
R7506:Vmn2r18 UTSW 5 151585020 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CATGCACCATTATTTCAGGCAC -3'
(R):5'- TCCTACTACCCAGGAGAATTTTACTTC -3'

Sequencing Primer
(F):5'- TATTTCAGGCACATACACACCCATTG -3'
(R):5'- CCTGCTTTGCTATGTGGA -3'
Posted On2018-02-28