Incidental Mutation 'R6244:Tmc5'
ID 505453
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Name transmembrane channel-like gene family 5
Synonyms 4932443L08Rik
MMRRC Submission 044435-MU
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 118597297-118675086 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 118634214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 84 (G84C)
Ref Sequence ENSEMBL: ENSMUSP00000049784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
AlphaFold Q32NZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000057320
AA Change: G84C

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: G84C

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098088
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121715
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121744
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 (GRCm38) V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 (GRCm38) H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 (GRCm38) M499K probably benign Het
Adgrv1 G A 13: 81,106,931 (GRCm38) T211I probably damaging Het
Adss C T 1: 177,776,829 (GRCm38) E153K probably benign Het
Ago4 C A 4: 126,511,487 (GRCm38) G431V possibly damaging Het
Araf G T X: 20,860,100 (GRCm38) R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 (GRCm38) I769F probably damaging Het
Atp9a T C 2: 168,689,352 (GRCm38) probably null Het
Brap C A 5: 121,665,309 (GRCm38) D173E probably benign Het
Brca2 G T 5: 150,566,978 (GRCm38) R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 (GRCm38) P555Q probably benign Het
Ccser2 A G 14: 36,940,718 (GRCm38) S170P probably benign Het
Celsr2 T C 3: 108,393,128 (GRCm38) H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 (GRCm38) R174M probably damaging Het
Cfap57 T G 4: 118,579,410 (GRCm38) I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 (GRCm38) R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 (GRCm38) H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 (GRCm38) F592L probably damaging Het
Ddb1 A G 19: 10,625,923 (GRCm38) E865G probably damaging Het
Ddx50 A T 10: 62,621,566 (GRCm38) probably null Het
Dpp6 A G 5: 27,049,628 (GRCm38) T14A probably damaging Het
Echs1 C A 7: 140,113,069 (GRCm38) Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 (GRCm38) D587V probably damaging Het
Ect2l A T 10: 18,140,397 (GRCm38) Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 (GRCm38) G342S probably benign Het
Fbxo33 C A 12: 59,206,079 (GRCm38) K211N probably benign Het
Fchsd2 A G 7: 101,259,776 (GRCm38) probably null Het
Fen1 A G 19: 10,200,687 (GRCm38) V131A probably damaging Het
Fetub C T 16: 22,932,331 (GRCm38) R143C probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,657,240 (GRCm38) T206A possibly damaging Het
Fut1 A G 7: 45,619,306 (GRCm38) E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 (GRCm38) F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 (GRCm38) E296A probably damaging Het
Gm7145 T A 1: 117,986,140 (GRCm38) C251S probably damaging Het
Gpam G A 19: 55,070,985 (GRCm38) P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 (GRCm38) L87M possibly damaging Het
Itgae A G 11: 73,145,601 (GRCm38) S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 (GRCm38) D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 (GRCm38) Y511* probably null Het
Kdm3b T A 18: 34,793,005 (GRCm38) I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 (GRCm38) H39L probably benign Het
Kmo C T 1: 175,659,695 (GRCm38) T404I possibly damaging Het
Krt222 C T 11: 99,235,058 (GRCm38) probably null Het
Magi3 G C 3: 104,015,697 (GRCm38) H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 (GRCm38) G81C probably damaging Het
Med15 G A 16: 17,652,745 (GRCm38) Q583* probably null Het
Mroh2a T C 1: 88,256,754 (GRCm38) V1453A probably benign Het
Myh13 A G 11: 67,362,501 (GRCm38) M1488V probably benign Het
Naip2 A T 13: 100,152,137 (GRCm38) F1193L probably damaging Het
Nop58 T A 1: 59,702,855 (GRCm38) M181K probably damaging Het
Npepps A T 11: 97,213,790 (GRCm38) V796D probably damaging Het
Nr1d1 A G 11: 98,770,537 (GRCm38) F301S probably damaging Het
Nynrin G A 14: 55,868,028 (GRCm38) V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 (GRCm38) T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 (GRCm38) Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 (GRCm38) T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 (GRCm38) C310S probably benign Het
Olfr61 C A 7: 140,638,433 (GRCm38) S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 (GRCm38) C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 (GRCm38) probably null Het
Polr2a G A 11: 69,744,226 (GRCm38) T569M probably damaging Het
Prr29 A G 11: 106,376,632 (GRCm38) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 (GRCm38) probably benign Homo
Sc5d T C 9: 42,255,421 (GRCm38) E274G probably benign Het
Serpina1d A T 12: 103,764,828 (GRCm38) probably null Het
Serpinb11 T A 1: 107,372,242 (GRCm38) I106N probably damaging Het
Setd2 G A 9: 110,548,665 (GRCm38) R516K probably damaging Het
Sirt2 G T 7: 28,787,797 (GRCm38) C291F probably damaging Het
Stac3 T C 10: 127,508,175 (GRCm38) V314A probably damaging Het
Stat6 C T 10: 127,657,712 (GRCm38) probably null Het
Strn3 A G 12: 51,610,107 (GRCm38) V712A probably damaging Het
Tnik C A 3: 28,650,179 (GRCm38) L996I probably damaging Het
Trim30d G T 7: 104,487,610 (GRCm38) T129K probably damaging Het
Triml1 G T 8: 43,138,756 (GRCm38) Y188* probably null Het
Trpc7 A G 13: 56,773,892 (GRCm38) Y760H probably damaging Het
Uaca G A 9: 60,870,044 (GRCm38) R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 (GRCm38) Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 (GRCm38) C61* probably null Het
Vmn2r18 A T 5: 151,584,651 (GRCm38) V336E probably damaging Het
Vwa8 T C 14: 79,086,662 (GRCm38) V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 (GRCm38) V24A probably benign Het
Zfp354c A G 11: 50,814,971 (GRCm38) Y426H probably benign Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118,656,787 (GRCm38) missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118,623,824 (GRCm38) unclassified probably benign
IGL01633:Tmc5 APN 7 118,623,586 (GRCm38) missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118,652,510 (GRCm38) missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118,645,324 (GRCm38) missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118,627,233 (GRCm38) missense probably benign 0.36
IGL02890:Tmc5 APN 7 118,645,430 (GRCm38) splice site probably benign
hipster UTSW 7 118,666,611 (GRCm38) critical splice donor site probably null
F5426:Tmc5 UTSW 7 118,623,323 (GRCm38) missense probably benign
PIT4802001:Tmc5 UTSW 7 118,672,226 (GRCm38) missense probably benign
R0068:Tmc5 UTSW 7 118,634,237 (GRCm38) missense probably benign 0.44
R0470:Tmc5 UTSW 7 118,639,931 (GRCm38) missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118,666,576 (GRCm38) missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118,627,210 (GRCm38) missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118,666,870 (GRCm38) missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118,666,593 (GRCm38) missense probably benign 0.30
R1486:Tmc5 UTSW 7 118,673,432 (GRCm38) missense probably benign 0.02
R1702:Tmc5 UTSW 7 118,672,239 (GRCm38) missense probably benign 0.00
R2188:Tmc5 UTSW 7 118,654,955 (GRCm38) missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118,645,395 (GRCm38) missense probably benign 0.01
R3893:Tmc5 UTSW 7 118,645,369 (GRCm38) missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118,652,655 (GRCm38) nonsense probably null
R4171:Tmc5 UTSW 7 118,649,587 (GRCm38) missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118,674,663 (GRCm38) makesense probably null
R4554:Tmc5 UTSW 7 118,670,733 (GRCm38) missense probably benign 0.16
R4555:Tmc5 UTSW 7 118,670,733 (GRCm38) missense probably benign 0.16
R4557:Tmc5 UTSW 7 118,670,733 (GRCm38) missense probably benign 0.16
R4833:Tmc5 UTSW 7 118,628,829 (GRCm38) missense probably benign 0.11
R4845:Tmc5 UTSW 7 118,642,381 (GRCm38) missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118,645,339 (GRCm38) missense probably benign 0.32
R5087:Tmc5 UTSW 7 118,645,386 (GRCm38) missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118,647,932 (GRCm38) missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118,672,193 (GRCm38) missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118,666,611 (GRCm38) critical splice donor site probably null
R5882:Tmc5 UTSW 7 118,654,919 (GRCm38) missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118,670,725 (GRCm38) missense probably damaging 1.00
R6360:Tmc5 UTSW 7 118,633,966 (GRCm38) start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118,656,814 (GRCm38) missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118,645,316 (GRCm38) missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118,647,844 (GRCm38) missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118,669,304 (GRCm38) missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118,639,956 (GRCm38) missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118,670,666 (GRCm38) missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118,623,597 (GRCm38) nonsense probably null
R7562:Tmc5 UTSW 7 118,623,326 (GRCm38) missense probably benign 0.10
R7808:Tmc5 UTSW 7 118,669,217 (GRCm38) missense probably damaging 1.00
R8560:Tmc5 UTSW 7 118,669,291 (GRCm38) missense probably damaging 1.00
R8682:Tmc5 UTSW 7 118,670,702 (GRCm38) missense possibly damaging 0.77
R8778:Tmc5 UTSW 7 118,623,593 (GRCm38) missense unknown
R8832:Tmc5 UTSW 7 118,623,109 (GRCm38) missense probably benign 0.06
R9026:Tmc5 UTSW 7 118,642,371 (GRCm38) missense possibly damaging 0.92
R9064:Tmc5 UTSW 7 118,634,047 (GRCm38) missense probably benign 0.01
R9159:Tmc5 UTSW 7 118,634,041 (GRCm38) missense probably benign
R9258:Tmc5 UTSW 7 118,623,278 (GRCm38) missense probably benign 0.00
Z1177:Tmc5 UTSW 7 118,623,756 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGTTCAGAATCACCTAG -3'
(R):5'- TGAGCATACTAATAAAAGCCCCTTG -3'

Sequencing Primer
(F):5'- GGGTTCAGAATCACCTAGTCTCAAG -3'
(R):5'- CTAATAAAAGCCCCTTGTTGTGC -3'
Posted On 2018-02-28