Mutagenetix > Incidental Mutations

Incidental Mutation 'R6244:Stac3'

505464

Institutional Source

Beutler Lab

Gene Symbol

Stac3

Ensembl Gene

ENSMUSG00000040287

Gene Name

SH3 and cysteine rich domain 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6244 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127501686-127508823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127508175 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 314 (V314A)

Ref Sequence

ENSEMBL: ENSMUSP00000125124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000160019]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035839
AA Change: V314A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: V314A

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160019
AA Change: V314A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: V314A

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	65	81	N/A	INTRINSIC
C1	89	139	2.19e-7	SMART
low complexity region	199	213	N/A	INTRINSIC
low complexity region	220	238	N/A	INTRINSIC
SH3	246	301	1.41e-16	SMART
SH3	305	360	8.45e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162302

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,956,999	V1782A	probably benign	Het
6430550D23Rik	T	C	2: 156,003,230	H113R	possibly damaging	Het
Adgrf3	A	T	5: 30,197,533	M499K	probably benign	Het
Adgrv1	G	A	13: 81,106,931	T211I	probably damaging	Het
Adss	C	T	1: 177,776,829	E153K	probably benign	Het
Ago4	C	A	4: 126,511,487	G431V	possibly damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Atp2b4	T	A	1: 133,726,561	I769F	probably damaging	Het
Atp9a	T	C	2: 168,689,352		probably null	Het
Brap	C	A	5: 121,665,309	D173E	probably benign	Het
Brca2	G	T	5: 150,566,978	R3035L	probably benign	Het
Ccdc8	C	A	7: 16,996,251	P555Q	probably benign	Het
Ccser2	A	G	14: 36,940,718	S170P	probably benign	Het
Celsr2	T	C	3: 108,393,128	H860R	probably damaging	Het
Cenpc1	C	A	5: 86,046,385	R174M	probably damaging	Het
Cfap57	T	G	4: 118,579,410	I930L	probably damaging	Het
Cx3cr1	C	T	9: 120,051,694	R214H	probably damaging	Het
Cyp4f14	T	A	17: 32,906,317	H429L	probably benign	Het
D5Ertd579e	A	G	5: 36,615,276	F592L	probably damaging	Het
Ddb1	A	G	19: 10,625,923	E865G	probably damaging	Het
Ddx50	A	T	10: 62,621,566		probably null	Het
Dpp6	A	G	5: 27,049,628	T14A	probably damaging	Het
Echs1	C	A	7: 140,113,069	Q51H	possibly damaging	Het
Ecm2	A	T	13: 49,530,307	D587V	probably damaging	Het
Ect2l	A	T	10: 18,140,397	Y666N	possibly damaging	Het
Epha2	G	A	4: 141,316,912	G342S	probably benign	Het
Fbxo33	C	A	12: 59,206,079	K211N	probably benign	Het
Fchsd2	A	G	7: 101,259,776		probably null	Het
Fen1	A	G	19: 10,200,687	V131A	probably damaging	Het
Fetub	C	T	16: 22,932,331	R143C	probably damaging	Het
Flnb	A	G	14: 7,892,092	E587G	probably damaging	Het
Foxd3	A	G	4: 99,657,240	T206A	possibly damaging	Het
Fut1	A	G	7: 45,619,306	E228G	possibly damaging	Het
Galnt13	T	C	2: 54,933,548	F379L	probably damaging	Het
Gcnt2	A	C	13: 40,861,241	E296A	probably damaging	Het
Gm7145	T	A	1: 117,986,140	C251S	probably damaging	Het
Gpam	G	A	19: 55,070,985	P810L	probably damaging	Het
Il1rl2	T	A	1: 40,327,566	L87M	possibly damaging	Het
Itgae	A	G	11: 73,145,601	S1122G	probably damaging	Het
Kcnh7	T	A	2: 63,182,226	D46V	probably damaging	Het
Kcnn3	T	G	3: 89,645,523	Y511*	probably null	Het
Kdm3b	T	A	18: 34,793,005	I66N	probably damaging	Het
Klk1b27	A	T	7: 44,054,550	H39L	probably benign	Het
Kmo	C	T	1: 175,659,695	T404I	possibly damaging	Het
Krt222	C	T	11: 99,235,058		probably null	Het
Magi3	G	C	3: 104,015,697	H1235D	probably benign	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Med15	G	A	16: 17,652,745	Q583*	probably null	Het
Mroh2a	T	C	1: 88,256,754	V1453A	probably benign	Het
Myh13	A	G	11: 67,362,501	M1488V	probably benign	Het
Naip2	A	T	13: 100,152,137	F1193L	probably damaging	Het
Nop58	T	A	1: 59,702,855	M181K	probably damaging	Het
Npepps	A	T	11: 97,213,790	V796D	probably damaging	Het
Nr1d1	A	G	11: 98,770,537	F301S	probably damaging	Het
Nynrin	G	A	14: 55,868,028	V832I	probably damaging	Het
Olfr1046	T	A	2: 86,217,222	T163S	possibly damaging	Het
Olfr1508	T	A	14: 52,463,895	Y38F	probably damaging	Het
Olfr320	A	T	11: 58,684,004	T44S	possibly damaging	Het
Olfr342	T	A	2: 36,528,341	C310S	probably benign	Het
Olfr61	C	A	7: 140,638,433	S244Y	probably damaging	Het
Phrf1	T	A	7: 141,237,673	C132S	probably damaging	Het
Plekhn1	T	C	4: 156,230,558		probably null	Het
Polr2a	G	A	11: 69,744,226	T569M	probably damaging	Het
Prr29	A	G	11: 106,376,632		probably null	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Homo
Sc5d	T	C	9: 42,255,421	E274G	probably benign	Het
Serpina1d	A	T	12: 103,764,828		probably null	Het
Serpinb11	T	A	1: 107,372,242	I106N	probably damaging	Het
Setd2	G	A	9: 110,548,665	R516K	probably damaging	Het
Sirt2	G	T	7: 28,787,797	C291F	probably damaging	Het
Stat6	C	T	10: 127,657,712		probably null	Het
Strn3	A	G	12: 51,610,107	V712A	probably damaging	Het
Tmc5	G	T	7: 118,634,214	G84C	possibly damaging	Het
Tnik	C	A	3: 28,650,179	L996I	probably damaging	Het
Trim30d	G	T	7: 104,487,610	T129K	probably damaging	Het
Triml1	G	T	8: 43,138,756	Y188*	probably null	Het
Trpc7	A	G	13: 56,773,892	Y760H	probably damaging	Het
Uaca	G	A	9: 60,870,044	R571Q	probably damaging	Het
Ubash3a	A	T	17: 31,239,272	Q575L	possibly damaging	Het
Usp49	T	A	17: 47,672,902	C61*	probably null	Het
Vmn2r18	A	T	5: 151,584,651	V336E	probably damaging	Het
Vwa8	T	C	14: 79,086,662	V1135A	probably benign	Het
Zcchc4	T	C	5: 52,783,161	V24A	probably benign	Het
Zfp354c	A	G	11: 50,814,971	Y426H	probably benign	Het

Other mutations in Stac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Stac3	APN	10	127503664	missense	probably damaging	1.00
IGL02271:Stac3	APN	10	127503899	missense	probably benign	0.00
R0051:Stac3	UTSW	10	127508148	missense	probably damaging	0.98
R0090:Stac3	UTSW	10	127503930	unclassified	probably benign
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0131:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0132:Stac3	UTSW	10	127503650	missense	probably damaging	0.97
R0330:Stac3	UTSW	10	127507747	splice site	probably null
R0630:Stac3	UTSW	10	127507763	missense	probably damaging	1.00
R1132:Stac3	UTSW	10	127507259	missense	probably benign
R1450:Stac3	UTSW	10	127504885	missense	probably damaging	1.00
R1739:Stac3	UTSW	10	127507766	missense	probably benign	0.40
R2316:Stac3	UTSW	10	127503360	splice site	probably null
R2511:Stac3	UTSW	10	127503918	critical splice donor site	probably null
R3000:Stac3	UTSW	10	127508147	missense	probably benign	0.01
R4324:Stac3	UTSW	10	127503249	missense	probably damaging	0.99
R4758:Stac3	UTSW	10	127503345	missense	possibly damaging	0.95
R5040:Stac3	UTSW	10	127508124	missense	probably damaging	0.98
R6275:Stac3	UTSW	10	127507746	nonsense	probably null
R7335:Stac3	UTSW	10	127504900	missense	probably benign	0.22
R8191:Stac3	UTSW	10	127508199	missense	probably damaging	1.00
R8290:Stac3	UTSW	10	127503360	splice site	probably null
R8410:Stac3	UTSW	10	127503330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAAGACGTTGCCACCGCTAAG -3'
(R):5'- TGACGTAACCACCAGCTTCATC -3'

Sequencing Primer
(F):5'- CTAAGGTGGGAGATGGGCAGTC -3'
(R):5'- CTGCACTACGATCTAGGGGTTTAAAG -3'

Posted On

2018-02-28