Incidental Mutation 'R6244:Stat6'
ID 505465
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Name signal transducer and activator of transcription 6
Synonyms
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127478855-127496826 bp(+) (GRCm39)
Type of Mutation splice site (10 bp from exon)
DNA Base Change (assembly) C to T at 127493581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157]
AlphaFold P52633
Predicted Effect probably benign
Transcript: ENSMUST00000026469
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099157
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156231
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik T C 2: 155,845,150 (GRCm39) H113R possibly damaging Het
Adgrf3 A T 5: 30,402,531 (GRCm39) M499K probably benign Het
Adgrv1 G A 13: 81,255,050 (GRCm39) T211I probably damaging Het
Adss2 C T 1: 177,604,395 (GRCm39) E153K probably benign Het
Ago4 C A 4: 126,405,280 (GRCm39) G431V possibly damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Atp2b4 T A 1: 133,654,299 (GRCm39) I769F probably damaging Het
Atp9a T C 2: 168,531,272 (GRCm39) probably null Het
Bltp1 T C 3: 37,011,148 (GRCm39) V1782A probably benign Het
Brap C A 5: 121,803,372 (GRCm39) D173E probably benign Het
Brca2 G T 5: 150,490,443 (GRCm39) R3035L probably benign Het
Ccdc8 C A 7: 16,730,176 (GRCm39) P555Q probably benign Het
Ccser2 A G 14: 36,662,675 (GRCm39) S170P probably benign Het
Celsr2 T C 3: 108,300,444 (GRCm39) H860R probably damaging Het
Cenpc1 C A 5: 86,194,244 (GRCm39) R174M probably damaging Het
Cfap57 T G 4: 118,436,607 (GRCm39) I930L probably damaging Het
Cx3cr1 C T 9: 119,880,760 (GRCm39) R214H probably damaging Het
Cyp4f14 T A 17: 33,125,291 (GRCm39) H429L probably benign Het
D5Ertd579e A G 5: 36,772,620 (GRCm39) F592L probably damaging Het
Ddb1 A G 19: 10,603,287 (GRCm39) E865G probably damaging Het
Ddx50 A T 10: 62,457,345 (GRCm39) probably null Het
Dpp6 A G 5: 27,254,626 (GRCm39) T14A probably damaging Het
Echs1 C A 7: 139,692,982 (GRCm39) Q51H possibly damaging Het
Ecm2 A T 13: 49,683,783 (GRCm39) D587V probably damaging Het
Ect2l A T 10: 18,016,145 (GRCm39) Y666N possibly damaging Het
Epha2 G A 4: 141,044,223 (GRCm39) G342S probably benign Het
Fbxo33 C A 12: 59,252,865 (GRCm39) K211N probably benign Het
Fchsd2 A G 7: 100,908,983 (GRCm39) probably null Het
Fen1 A G 19: 10,178,051 (GRCm39) V131A probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,545,477 (GRCm39) T206A possibly damaging Het
Fut1 A G 7: 45,268,730 (GRCm39) E228G possibly damaging Het
Galnt13 T C 2: 54,823,560 (GRCm39) F379L probably damaging Het
Gcnt2 A C 13: 41,014,717 (GRCm39) E296A probably damaging Het
Gm7145 T A 1: 117,913,870 (GRCm39) C251S probably damaging Het
Gpam G A 19: 55,059,417 (GRCm39) P810L probably damaging Het
Il1rl2 T A 1: 40,366,726 (GRCm39) L87M possibly damaging Het
Itgae A G 11: 73,036,427 (GRCm39) S1122G probably damaging Het
Kcnh7 T A 2: 63,012,570 (GRCm39) D46V probably damaging Het
Kcnn3 T G 3: 89,552,830 (GRCm39) Y511* probably null Het
Kdm3b T A 18: 34,926,058 (GRCm39) I66N probably damaging Het
Klk1b27 A T 7: 43,703,974 (GRCm39) H39L probably benign Het
Kmo C T 1: 175,487,261 (GRCm39) T404I possibly damaging Het
Krt222 C T 11: 99,125,884 (GRCm39) probably null Het
Magi3 G C 3: 103,923,013 (GRCm39) H1235D probably benign Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Med15 G A 16: 17,470,609 (GRCm39) Q583* probably null Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh13 A G 11: 67,253,327 (GRCm39) M1488V probably benign Het
Naip2 A T 13: 100,288,645 (GRCm39) F1193L probably damaging Het
Nop58 T A 1: 59,742,014 (GRCm39) M181K probably damaging Het
Npepps A T 11: 97,104,616 (GRCm39) V796D probably damaging Het
Nr1d1 A G 11: 98,661,363 (GRCm39) F301S probably damaging Het
Nynrin G A 14: 56,105,485 (GRCm39) V832I probably damaging Het
Or13a28 C A 7: 140,218,346 (GRCm39) S244Y probably damaging Het
Or1j14 T A 2: 36,418,353 (GRCm39) C310S probably benign Het
Or2ak7 A T 11: 58,574,830 (GRCm39) T44S possibly damaging Het
Or4e1 T A 14: 52,701,352 (GRCm39) Y38F probably damaging Het
Or8k1 T A 2: 86,047,566 (GRCm39) T163S possibly damaging Het
Phrf1 T A 7: 140,817,586 (GRCm39) C132S probably damaging Het
Plekhn1 T C 4: 156,315,015 (GRCm39) probably null Het
Polr2a G A 11: 69,635,052 (GRCm39) T569M probably damaging Het
Prr29 A G 11: 106,267,458 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Sc5d T C 9: 42,166,717 (GRCm39) E274G probably benign Het
Serpina1d A T 12: 103,731,087 (GRCm39) probably null Het
Serpinb11 T A 1: 107,299,972 (GRCm39) I106N probably damaging Het
Setd2 G A 9: 110,377,733 (GRCm39) R516K probably damaging Het
Sirt2 G T 7: 28,487,222 (GRCm39) C291F probably damaging Het
Stac3 T C 10: 127,344,044 (GRCm39) V314A probably damaging Het
Strn3 A G 12: 51,656,890 (GRCm39) V712A probably damaging Het
Tmc5 G T 7: 118,233,437 (GRCm39) G84C possibly damaging Het
Tnik C A 3: 28,704,328 (GRCm39) L996I probably damaging Het
Trim30d G T 7: 104,136,817 (GRCm39) T129K probably damaging Het
Triml1 G T 8: 43,591,793 (GRCm39) Y188* probably null Het
Trpc7 A G 13: 56,921,705 (GRCm39) Y760H probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ubash3a A T 17: 31,458,246 (GRCm39) Q575L possibly damaging Het
Usp49 T A 17: 47,983,827 (GRCm39) C61* probably null Het
Vmn2r18 A T 5: 151,508,116 (GRCm39) V336E probably damaging Het
Vwa8 T C 14: 79,324,102 (GRCm39) V1135A probably benign Het
Zcchc4 T C 5: 52,940,503 (GRCm39) V24A probably benign Het
Zfp354c A G 11: 50,705,798 (GRCm39) Y426H probably benign Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127,490,801 (GRCm39) missense probably damaging 1.00
IGL01785:Stat6 APN 10 127,493,096 (GRCm39) missense probably damaging 1.00
IGL02939:Stat6 APN 10 127,482,809 (GRCm39) missense probably benign 0.05
IGL03266:Stat6 APN 10 127,493,024 (GRCm39) missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127,494,074 (GRCm39) missense probably benign 0.00
Rigid UTSW 10 127,494,571 (GRCm39) critical splice donor site probably null
Stationary UTSW 10 127,488,091 (GRCm39) missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127,494,099 (GRCm39) missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127,493,096 (GRCm39) missense probably damaging 0.98
R0581:Stat6 UTSW 10 127,483,985 (GRCm39) missense probably damaging 0.99
R0735:Stat6 UTSW 10 127,494,110 (GRCm39) missense probably damaging 1.00
R1333:Stat6 UTSW 10 127,487,094 (GRCm39) missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127,486,680 (GRCm39) missense probably benign 0.32
R1457:Stat6 UTSW 10 127,494,114 (GRCm39) missense probably damaging 0.98
R1538:Stat6 UTSW 10 127,489,125 (GRCm39) missense probably damaging 1.00
R1696:Stat6 UTSW 10 127,488,918 (GRCm39) missense probably damaging 1.00
R2016:Stat6 UTSW 10 127,486,665 (GRCm39) missense probably damaging 1.00
R3236:Stat6 UTSW 10 127,488,091 (GRCm39) missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127,491,248 (GRCm39) missense probably damaging 1.00
R4467:Stat6 UTSW 10 127,487,097 (GRCm39) missense probably damaging 1.00
R5346:Stat6 UTSW 10 127,488,182 (GRCm39) missense probably benign 0.44
R5481:Stat6 UTSW 10 127,483,695 (GRCm39) splice site probably null
R5722:Stat6 UTSW 10 127,494,242 (GRCm39) missense probably benign 0.00
R6036:Stat6 UTSW 10 127,491,313 (GRCm39) missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127,491,313 (GRCm39) missense possibly damaging 0.58
R6914:Stat6 UTSW 10 127,487,131 (GRCm39) missense probably damaging 1.00
R6937:Stat6 UTSW 10 127,494,571 (GRCm39) critical splice donor site probably null
R6942:Stat6 UTSW 10 127,487,131 (GRCm39) missense probably damaging 1.00
R8231:Stat6 UTSW 10 127,482,842 (GRCm39) missense possibly damaging 0.61
R8995:Stat6 UTSW 10 127,494,511 (GRCm39) missense probably benign 0.00
R9162:Stat6 UTSW 10 127,487,089 (GRCm39) missense probably damaging 0.99
R9192:Stat6 UTSW 10 127,493,479 (GRCm39) missense probably damaging 1.00
R9252:Stat6 UTSW 10 127,483,661 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTCTCATTCCTCTCCTAGGC -3'
(R):5'- TATCCCACTGCCACAGAGGT -3'

Sequencing Primer
(F):5'- TCTCCTAGGCTCCTCACAGATAGAG -3'
(R):5'- AAGGTTGATGGGCAGGTG -3'
Posted On 2018-02-28