Incidental Mutation 'R6244:Zfp354c'
ID 505466
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Name zinc finger protein 354C
Synonyms 5330421P20Rik, Kid3, AJ18
MMRRC Submission 044435-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6244 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 50701913-50718551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50705798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 426 (Y426H)
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
AlphaFold Q571J5
Predicted Effect probably benign
Transcript: ENSMUST00000000632
AA Change: Y426H

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807
AA Change: Y426H

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
AA Change: Y426H

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807
AA Change: Y426H

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139465
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik T C 2: 155,845,150 (GRCm39) H113R possibly damaging Het
Adgrf3 A T 5: 30,402,531 (GRCm39) M499K probably benign Het
Adgrv1 G A 13: 81,255,050 (GRCm39) T211I probably damaging Het
Adss2 C T 1: 177,604,395 (GRCm39) E153K probably benign Het
Ago4 C A 4: 126,405,280 (GRCm39) G431V possibly damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Atp2b4 T A 1: 133,654,299 (GRCm39) I769F probably damaging Het
Atp9a T C 2: 168,531,272 (GRCm39) probably null Het
Bltp1 T C 3: 37,011,148 (GRCm39) V1782A probably benign Het
Brap C A 5: 121,803,372 (GRCm39) D173E probably benign Het
Brca2 G T 5: 150,490,443 (GRCm39) R3035L probably benign Het
Ccdc8 C A 7: 16,730,176 (GRCm39) P555Q probably benign Het
Ccser2 A G 14: 36,662,675 (GRCm39) S170P probably benign Het
Celsr2 T C 3: 108,300,444 (GRCm39) H860R probably damaging Het
Cenpc1 C A 5: 86,194,244 (GRCm39) R174M probably damaging Het
Cfap57 T G 4: 118,436,607 (GRCm39) I930L probably damaging Het
Cx3cr1 C T 9: 119,880,760 (GRCm39) R214H probably damaging Het
Cyp4f14 T A 17: 33,125,291 (GRCm39) H429L probably benign Het
D5Ertd579e A G 5: 36,772,620 (GRCm39) F592L probably damaging Het
Ddb1 A G 19: 10,603,287 (GRCm39) E865G probably damaging Het
Ddx50 A T 10: 62,457,345 (GRCm39) probably null Het
Dpp6 A G 5: 27,254,626 (GRCm39) T14A probably damaging Het
Echs1 C A 7: 139,692,982 (GRCm39) Q51H possibly damaging Het
Ecm2 A T 13: 49,683,783 (GRCm39) D587V probably damaging Het
Ect2l A T 10: 18,016,145 (GRCm39) Y666N possibly damaging Het
Epha2 G A 4: 141,044,223 (GRCm39) G342S probably benign Het
Fbxo33 C A 12: 59,252,865 (GRCm39) K211N probably benign Het
Fchsd2 A G 7: 100,908,983 (GRCm39) probably null Het
Fen1 A G 19: 10,178,051 (GRCm39) V131A probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Flnb A G 14: 7,892,092 (GRCm38) E587G probably damaging Het
Foxd3 A G 4: 99,545,477 (GRCm39) T206A possibly damaging Het
Fut1 A G 7: 45,268,730 (GRCm39) E228G possibly damaging Het
Galnt13 T C 2: 54,823,560 (GRCm39) F379L probably damaging Het
Gcnt2 A C 13: 41,014,717 (GRCm39) E296A probably damaging Het
Gm7145 T A 1: 117,913,870 (GRCm39) C251S probably damaging Het
Gpam G A 19: 55,059,417 (GRCm39) P810L probably damaging Het
Il1rl2 T A 1: 40,366,726 (GRCm39) L87M possibly damaging Het
Itgae A G 11: 73,036,427 (GRCm39) S1122G probably damaging Het
Kcnh7 T A 2: 63,012,570 (GRCm39) D46V probably damaging Het
Kcnn3 T G 3: 89,552,830 (GRCm39) Y511* probably null Het
Kdm3b T A 18: 34,926,058 (GRCm39) I66N probably damaging Het
Klk1b27 A T 7: 43,703,974 (GRCm39) H39L probably benign Het
Kmo C T 1: 175,487,261 (GRCm39) T404I possibly damaging Het
Krt222 C T 11: 99,125,884 (GRCm39) probably null Het
Magi3 G C 3: 103,923,013 (GRCm39) H1235D probably benign Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Med15 G A 16: 17,470,609 (GRCm39) Q583* probably null Het
Mroh2a T C 1: 88,184,476 (GRCm39) V1453A probably benign Het
Myh13 A G 11: 67,253,327 (GRCm39) M1488V probably benign Het
Naip2 A T 13: 100,288,645 (GRCm39) F1193L probably damaging Het
Nop58 T A 1: 59,742,014 (GRCm39) M181K probably damaging Het
Npepps A T 11: 97,104,616 (GRCm39) V796D probably damaging Het
Nr1d1 A G 11: 98,661,363 (GRCm39) F301S probably damaging Het
Nynrin G A 14: 56,105,485 (GRCm39) V832I probably damaging Het
Or13a28 C A 7: 140,218,346 (GRCm39) S244Y probably damaging Het
Or1j14 T A 2: 36,418,353 (GRCm39) C310S probably benign Het
Or2ak7 A T 11: 58,574,830 (GRCm39) T44S possibly damaging Het
Or4e1 T A 14: 52,701,352 (GRCm39) Y38F probably damaging Het
Or8k1 T A 2: 86,047,566 (GRCm39) T163S possibly damaging Het
Phrf1 T A 7: 140,817,586 (GRCm39) C132S probably damaging Het
Plekhn1 T C 4: 156,315,015 (GRCm39) probably null Het
Polr2a G A 11: 69,635,052 (GRCm39) T569M probably damaging Het
Prr29 A G 11: 106,267,458 (GRCm39) probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,229,115 (GRCm39) probably benign Homo
Sc5d T C 9: 42,166,717 (GRCm39) E274G probably benign Het
Serpina1d A T 12: 103,731,087 (GRCm39) probably null Het
Serpinb11 T A 1: 107,299,972 (GRCm39) I106N probably damaging Het
Setd2 G A 9: 110,377,733 (GRCm39) R516K probably damaging Het
Sirt2 G T 7: 28,487,222 (GRCm39) C291F probably damaging Het
Stac3 T C 10: 127,344,044 (GRCm39) V314A probably damaging Het
Stat6 C T 10: 127,493,581 (GRCm39) probably null Het
Strn3 A G 12: 51,656,890 (GRCm39) V712A probably damaging Het
Tmc5 G T 7: 118,233,437 (GRCm39) G84C possibly damaging Het
Tnik C A 3: 28,704,328 (GRCm39) L996I probably damaging Het
Trim30d G T 7: 104,136,817 (GRCm39) T129K probably damaging Het
Triml1 G T 8: 43,591,793 (GRCm39) Y188* probably null Het
Trpc7 A G 13: 56,921,705 (GRCm39) Y760H probably damaging Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Ubash3a A T 17: 31,458,246 (GRCm39) Q575L possibly damaging Het
Usp49 T A 17: 47,983,827 (GRCm39) C61* probably null Het
Vmn2r18 A T 5: 151,508,116 (GRCm39) V336E probably damaging Het
Vwa8 T C 14: 79,324,102 (GRCm39) V1135A probably benign Het
Zcchc4 T C 5: 52,940,503 (GRCm39) V24A probably benign Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50,706,440 (GRCm39) missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50,708,732 (GRCm39) missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50,708,021 (GRCm39) missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50,706,457 (GRCm39) missense probably benign 0.12
R1370:Zfp354c UTSW 11 50,706,667 (GRCm39) missense probably benign
R2109:Zfp354c UTSW 11 50,707,969 (GRCm39) missense probably benign 0.01
R2850:Zfp354c UTSW 11 50,706,158 (GRCm39) nonsense probably null
R4010:Zfp354c UTSW 11 50,705,771 (GRCm39) missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50,705,866 (GRCm39) missense probably benign 0.14
R5430:Zfp354c UTSW 11 50,706,022 (GRCm39) missense probably benign 0.02
R5439:Zfp354c UTSW 11 50,706,597 (GRCm39) missense probably benign 0.01
R5905:Zfp354c UTSW 11 50,706,253 (GRCm39) missense probably damaging 1.00
R6264:Zfp354c UTSW 11 50,706,274 (GRCm39) missense probably benign 0.00
R6591:Zfp354c UTSW 11 50,705,602 (GRCm39) missense probably benign 0.41
R6650:Zfp354c UTSW 11 50,705,518 (GRCm39) missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50,705,602 (GRCm39) missense probably benign 0.41
R7087:Zfp354c UTSW 11 50,706,040 (GRCm39) missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50,705,483 (GRCm39) missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50,706,253 (GRCm39) missense probably damaging 1.00
R7619:Zfp354c UTSW 11 50,708,635 (GRCm39) critical splice donor site probably null
R7699:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7710:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7712:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7747:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7748:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7784:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7816:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7817:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7853:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7855:Zfp354c UTSW 11 50,706,067 (GRCm39) small deletion probably benign
R7870:Zfp354c UTSW 11 50,706,065 (GRCm39) small deletion probably benign
R8852:Zfp354c UTSW 11 50,706,019 (GRCm39) missense probably damaging 1.00
R8860:Zfp354c UTSW 11 50,706,019 (GRCm39) missense probably damaging 1.00
R8862:Zfp354c UTSW 11 50,708,718 (GRCm39) missense probably benign 0.15
R9169:Zfp354c UTSW 11 50,706,088 (GRCm39) missense probably damaging 1.00
R9215:Zfp354c UTSW 11 50,706,666 (GRCm39) missense probably benign 0.31
R9273:Zfp354c UTSW 11 50,706,059 (GRCm39) missense probably damaging 1.00
R9762:Zfp354c UTSW 11 50,706,239 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTCTACAAAGGTTTGACCTG -3'
(R):5'- AGTGTGGGAAGGCCTTCAG -3'

Sequencing Primer
(F):5'- GCTCGTGTTCAGTTAGGAATGAATAC -3'
(R):5'- GTGACAAGGCCTTTAACTGC -3'
Posted On 2018-02-28