Incidental Mutation 'R6244:Npepps'
ID505471
Institutional Source Beutler Lab
Gene Symbol Npepps
Ensembl Gene ENSMUSG00000001441
Gene Nameaminopeptidase puromycin sensitive
SynonymsMP100, Psa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R6244 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97205842-97280638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97213790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 796 (V796D)
Ref Sequence ENSEMBL: ENSMUSP00000127801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000167806] [ENSMUST00000172108]
Predicted Effect probably damaging
Transcript: ENSMUST00000001480
AA Change: V796D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441
AA Change: V796D

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 5.2e-155 PFAM
Pfam:ERAP1_C 579 892 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107608
Predicted Effect unknown
Transcript: ENSMUST00000165216
AA Change: V751D
SMART Domains Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441
AA Change: V751D

DomainStartEndE-ValueType
low complexity region 4 35 N/A INTRINSIC
Pfam:Peptidase_M1 46 183 1.6e-28 PFAM
Pfam:Peptidase_M1 174 398 2.9e-100 PFAM
Pfam:ERAP1_C 535 848 2.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165489
Predicted Effect possibly damaging
Transcript: ENSMUST00000167806
AA Change: V656D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441
AA Change: V656D

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 3e-153 PFAM
Pfam:Peptidase_MA_2 321 465 7.4e-24 PFAM
Pfam:ERAP1_C 579 632 5.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171320
Predicted Effect probably damaging
Transcript: ENSMUST00000172108
AA Change: V796D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441
AA Change: V796D

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 6e-153 PFAM
Pfam:Peptidase_MA_2 321 465 1.2e-23 PFAM
Pfam:ERAP1_C 579 859 5.7e-55 PFAM
low complexity region 868 886 N/A INTRINSIC
Meta Mutation Damage Score 0.9270 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,956,999 V1782A probably benign Het
6430550D23Rik T C 2: 156,003,230 H113R possibly damaging Het
Adgrf3 A T 5: 30,197,533 M499K probably benign Het
Adgrv1 G A 13: 81,106,931 T211I probably damaging Het
Adss C T 1: 177,776,829 E153K probably benign Het
Ago4 C A 4: 126,511,487 G431V possibly damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atp2b4 T A 1: 133,726,561 I769F probably damaging Het
Atp9a T C 2: 168,689,352 probably null Het
Brap C A 5: 121,665,309 D173E probably benign Het
Brca2 G T 5: 150,566,978 R3035L probably benign Het
Ccdc8 C A 7: 16,996,251 P555Q probably benign Het
Ccser2 A G 14: 36,940,718 S170P probably benign Het
Celsr2 T C 3: 108,393,128 H860R probably damaging Het
Cenpc1 C A 5: 86,046,385 R174M probably damaging Het
Cfap57 T G 4: 118,579,410 I930L probably damaging Het
Cx3cr1 C T 9: 120,051,694 R214H probably damaging Het
Cyp4f14 T A 17: 32,906,317 H429L probably benign Het
D5Ertd579e A G 5: 36,615,276 F592L probably damaging Het
Ddb1 A G 19: 10,625,923 E865G probably damaging Het
Ddx50 A T 10: 62,621,566 probably null Het
Dpp6 A G 5: 27,049,628 T14A probably damaging Het
Echs1 C A 7: 140,113,069 Q51H possibly damaging Het
Ecm2 A T 13: 49,530,307 D587V probably damaging Het
Ect2l A T 10: 18,140,397 Y666N possibly damaging Het
Epha2 G A 4: 141,316,912 G342S probably benign Het
Fbxo33 C A 12: 59,206,079 K211N probably benign Het
Fchsd2 A G 7: 101,259,776 probably null Het
Fen1 A G 19: 10,200,687 V131A probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Flnb A G 14: 7,892,092 E587G probably damaging Het
Foxd3 A G 4: 99,657,240 T206A possibly damaging Het
Fut1 A G 7: 45,619,306 E228G possibly damaging Het
Galnt13 T C 2: 54,933,548 F379L probably damaging Het
Gcnt2 A C 13: 40,861,241 E296A probably damaging Het
Gm7145 T A 1: 117,986,140 C251S probably damaging Het
Gpam G A 19: 55,070,985 P810L probably damaging Het
Il1rl2 T A 1: 40,327,566 L87M possibly damaging Het
Itgae A G 11: 73,145,601 S1122G probably damaging Het
Kcnh7 T A 2: 63,182,226 D46V probably damaging Het
Kcnn3 T G 3: 89,645,523 Y511* probably null Het
Kdm3b T A 18: 34,793,005 I66N probably damaging Het
Klk1b27 A T 7: 44,054,550 H39L probably benign Het
Kmo C T 1: 175,659,695 T404I possibly damaging Het
Krt222 C T 11: 99,235,058 probably null Het
Magi3 G C 3: 104,015,697 H1235D probably benign Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Med15 G A 16: 17,652,745 Q583* probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh13 A G 11: 67,362,501 M1488V probably benign Het
Naip2 A T 13: 100,152,137 F1193L probably damaging Het
Nop58 T A 1: 59,702,855 M181K probably damaging Het
Nr1d1 A G 11: 98,770,537 F301S probably damaging Het
Nynrin G A 14: 55,868,028 V832I probably damaging Het
Olfr1046 T A 2: 86,217,222 T163S possibly damaging Het
Olfr1508 T A 14: 52,463,895 Y38F probably damaging Het
Olfr320 A T 11: 58,684,004 T44S possibly damaging Het
Olfr342 T A 2: 36,528,341 C310S probably benign Het
Olfr61 C A 7: 140,638,433 S244Y probably damaging Het
Phrf1 T A 7: 141,237,673 C132S probably damaging Het
Plekhn1 T C 4: 156,230,558 probably null Het
Polr2a G A 11: 69,744,226 T569M probably damaging Het
Prr29 A G 11: 106,376,632 probably null Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Sc5d T C 9: 42,255,421 E274G probably benign Het
Serpina1d A T 12: 103,764,828 probably null Het
Serpinb11 T A 1: 107,372,242 I106N probably damaging Het
Setd2 G A 9: 110,548,665 R516K probably damaging Het
Sirt2 G T 7: 28,787,797 C291F probably damaging Het
Stac3 T C 10: 127,508,175 V314A probably damaging Het
Stat6 C T 10: 127,657,712 probably null Het
Strn3 A G 12: 51,610,107 V712A probably damaging Het
Tmc5 G T 7: 118,634,214 G84C possibly damaging Het
Tnik C A 3: 28,650,179 L996I probably damaging Het
Trim30d G T 7: 104,487,610 T129K probably damaging Het
Triml1 G T 8: 43,138,756 Y188* probably null Het
Trpc7 A G 13: 56,773,892 Y760H probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ubash3a A T 17: 31,239,272 Q575L possibly damaging Het
Usp49 T A 17: 47,672,902 C61* probably null Het
Vmn2r18 A T 5: 151,584,651 V336E probably damaging Het
Vwa8 T C 14: 79,086,662 V1135A probably benign Het
Zcchc4 T C 5: 52,783,161 V24A probably benign Het
Zfp354c A G 11: 50,814,971 Y426H probably benign Het
Other mutations in Npepps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Npepps APN 11 97236058 splice site probably benign
IGL00904:Npepps APN 11 97258306 missense probably damaging 0.99
IGL00925:Npepps APN 11 97280283 missense probably damaging 0.97
IGL01074:Npepps APN 11 97217811 missense probably damaging 0.98
IGL01869:Npepps APN 11 97236122 missense probably damaging 1.00
IGL01879:Npepps APN 11 97258340 missense possibly damaging 0.66
IGL02145:Npepps APN 11 97218502 splice site probably null
IGL02493:Npepps APN 11 97238159 missense probably damaging 1.00
IGL02561:Npepps APN 11 97229849 nonsense probably null
IGL02957:Npepps APN 11 97242652 missense probably damaging 1.00
IGL03008:Npepps APN 11 97238158 missense probably damaging 1.00
IGL03054:Npepps UTSW 11 97241788 intron probably benign
R0280:Npepps UTSW 11 97241014 missense possibly damaging 0.90
R0743:Npepps UTSW 11 97206058 utr 3 prime probably benign
R0838:Npepps UTSW 11 97267692 splice site probably benign
R1449:Npepps UTSW 11 97207154 missense probably benign 0.01
R1478:Npepps UTSW 11 97226847 missense probably benign 0.03
R1502:Npepps UTSW 11 97218575 missense possibly damaging 0.79
R1726:Npepps UTSW 11 97224669 missense probably damaging 1.00
R2413:Npepps UTSW 11 97240966 missense probably damaging 1.00
R3619:Npepps UTSW 11 97248265 missense possibly damaging 0.90
R4620:Npepps UTSW 11 97238244 missense probably damaging 1.00
R4782:Npepps UTSW 11 97226826 missense probably damaging 1.00
R4810:Npepps UTSW 11 97240933 missense probably damaging 1.00
R4998:Npepps UTSW 11 97206107 intron probably benign
R5086:Npepps UTSW 11 97217799 missense probably benign 0.01
R5289:Npepps UTSW 11 97240927 critical splice donor site probably null
R5740:Npepps UTSW 11 97236068 missense possibly damaging 0.85
R6004:Npepps UTSW 11 97223124 missense probably benign 0.03
R6181:Npepps UTSW 11 97242004 missense probably damaging 0.98
R6213:Npepps UTSW 11 97241997 nonsense probably null
R6318:Npepps UTSW 11 97218548 missense probably damaging 0.98
R6478:Npepps UTSW 11 97258273 critical splice donor site probably null
R6724:Npepps UTSW 11 97206002 utr 3 prime probably benign
R6890:Npepps UTSW 11 97267644 nonsense probably null
R7035:Npepps UTSW 11 97223139 missense probably damaging 0.99
R7426:Npepps UTSW 11 97213156 missense probably benign 0.19
R7749:Npepps UTSW 11 97267628 missense probably benign
R7819:Npepps UTSW 11 97248269 missense probably damaging 1.00
R7885:Npepps UTSW 11 97218648 missense probably damaging 1.00
R7968:Npepps UTSW 11 97218648 missense probably damaging 1.00
X0021:Npepps UTSW 11 97238120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCAGACACTTGACACACATCATG -3'
(R):5'- ACCTCAGTGGAAGAGAAGCC -3'

Sequencing Primer
(F):5'- TTTCCAGACAGAGTATCTCTATGTAG -3'
(R):5'- CCGGTATGAACATGCCTGGAATC -3'
Posted On2018-02-28